Caenorhabditis_elegans Locus Mono:4:ZK484.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:4:ZK484.9
Caenorhabditis_elegans
Mono:4:ZK484.9
I
ZK484.9
1001..1068
2068
TTTCTTCGGAGAGCATCTGAAAATATTTTTTGTTTGCTTTGAAAAACCTAAAATATTTC
AACATGCTTGACATGAATATATTCAGTATTTTTGACCAGCGTTCAGTATATTTATACAAA
ATCCCCCAATACCTATACTCCAAAAATCTTAAAATTTGACTTAGATTAACTTAGATATTG
CTTGATTTTTCTTCCAACTAGTTCCCAACTTACATCATACCAAACTCCGAAAATTTTATT
GACGAGGAAAATGATCGGAATATTGATCAAAGTGATCATTGAGAGCTTCCAAGACAGTGT
GAACATGAAGATTAAAGACCCGAAGAGCATTGTCAAGTTTCTTTAAAAATTTTAATTTTC
AAGTTTATCTTCGATATCTCACCTGGTAAGAACATTCATGTAGAGGGACAAAGTGTTCGA
CATTGTTTGACAATCAGCTGACAGTCGAGAGCAAATCTCTCCTGAAAGAAGTTACATTTC
TTACAGAAAACCATTATTTTGCTATTCTCCTCCACATTAAGTACGAACCAGTTTTATTCA
TATCAAAGAACCCAATCTCTTGCTTCACAACAGAACGGAATAGGTCATTTCGAATCTGTC
GATCGATTGTAGCGTGTGCATAGGTGAATGATCCTCCACGAAGACCACCAAATACAGTTC
TGAACATTTTTTTTCCAAAAGGATATTATTGTACAACTTACGAAGCCAATGAGAGCATTC
CCATTATGAAAACGGTTTTGTGAAGCTTCTCATATGAAGCTTTATCACCGAATACTGCTG
TTACTACTTCTCCAGTGTAATATGGAATGAACACTCGACCTGTATAATAATTGACCAATT
ACGAGTTTTATCAATTGATTTTTTCTTTCTTTAAACTTCACTAACAACTCTCCTTCTTTC
TCGCAAATAAAAGCGCCCTTCTCGCTTGTCTCGACTTGTTTCACTCGCGGCCTAGTGGTT
AACGCGGCCGGCTGCCGCTCGCCGCTCCCGAGTTCAACTCCACGCCACGTGATTTAGGTT
TATTTGCTACTCTTGATTAACTCTCATGATGACAAGAAAGTATGATGGCTTTTAAAACTT
TTTAATTTTTGAATAGAGAACTTACTAAGGGAGTAGCAGAAAAGGAAGAAGAATGCCATT
CCATAGTATTTCCACTGCCTTCCCATGTAGCCCAAAAGTCTGAACAACAATTGGAAGGTT
TCTCTTTGCTCTGCAGCTTTTTCAGCTTCCTCCTGACGGAGTCTCTCCTCGTGTTCAGCA
TCTCCAAAAAGAAGAGAATCTCCTGTTCCTGCTGCAACTTCTGTTACATGAGCAAGCACA
GAAGTCCAGATTCCTTGAAGAAGAAGTGAAGCGAAAATACACCAAATCATAAGAATCCAA
TCACCAACTGCCAACCGGATATTGTCATCTTCATAGAATGCTAGAAGTTTCGATGGAGCA
AATGCAACAATCAAGAGCATCATTGCAAAAACTACGTTCCTGGAAATTATCATGTTAACA
AAAAGTTTCAATGATTTGTTATTCGGGAATTTGGAATGCGCCTTCAAACGACGAGTACTG
TAACAAATTTGATTTTCTTTGAATTGATTTTTCCCACTTGAAGTTCTCAAAATTGGCAAC
TTACTTGACATTTTCGGCGACTTGTGAGAATCCGGAAGGTGAAGCCCATGCTGAAACTGC
TCCGCCGAGCAAAATACTGTCACGAATCAACGCAACCGCCTAAAATACTCAATTTATGGT
GGTTGAACAAAATTTTCTGATCTACCAAAAAATCTACTGGATTTTTCAAAAAACTATAGT
TGGCCAAATCAAACCAGTGAGCGATATTGTCGAACGTGAAGTACTGAAAAGAGATTTTGG
TTCGAATTTTGAACATATTTTCATACTTTTCCATTCCAAGCAAGTCCGAATACATTGACC
AGAAGATCGAGGCCAATGAACGCCAGGCATATGAAAAGGGCCTGGCCACCCGTGTAAAGA
GAAGAACTCATTCTTCTGAAAATCTCGAATTTCTCAAAATTGCTTAAAAAAAGAAAAAAG
TAACTAGAAATGTAACTTTTTGGAGTATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved