Caenorhabditis_elegans Locus Mono:43:T06C12.16
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:43:T06C12.16
Caenorhabditis_elegans
Mono:43:T06C12.16
V
T06C12.16
1001..1072
2072
TGACATTAAAATTGAAATCATCATCAATTTTATTCAGAAATTCGCGATCTCAAACGACC
AAATCCTCACGAAAGAGTTTACAATAGATTTTTCGGAGATTACGGATGTGCCAAACACTA
CTGTACAAGAGTGAGCAATAAATTTTAGTTAGTTTCTTTCAATTTAATTTTCAGAATGTT
TCGGCATTCAATGTCAAAAATGCATCATCAAGTCGCAAAGCCGTTGCTTGAACTCAGACC
GTCATCTATTGAAACGGCGTACATGCTCACTCAGATGAGCTGGCAAGTTGCAGGTAAGAA
AATATTTCAAAAAGGTTACCTGGCACTTTTGATCGAACAAGGACTAAGATAAAAGCTGTC
AAAATTAAAAAAAAAAAGACTTAACATAAGGCTACGCTCAAGCCTAAGCCTAAACCTACA
TATAAGCCTAATAGTGAGCCGTCAACATTTAAATTCAACTTTTTAGGTAAGAAAATGCAA
GGAAAAGTCGTCGAAATCGGTGAACGAGTTTGTGATGAGCTGGCAAATAATCTTCACAGC
TACTATCTGAAAGAAGAAATGCGATCGAATTATGCAGGTCGCCTGGTTCGCCTGATGAGC
GTTGTTAATTCTGTTAAAAAGATTCACATGGAAAGAAGTATGACTATGGAGTTGGCCAGA
ATTTTTGAAGTTTTTAAGGTCGACTTTTCTGAACCGGACATTTTTGATTGTTAGTTTTGT
TCTAGTCTTTTGTACTCTTTCTAGTTGTACTTATTGTTAAAATTAAGCTAAAATGCAAAA
TTTCACTTAAAATTGTACTTATTAATACGGCTGAAAATGAATAAATGATGTATTTAGTAC
TGCTAAAGCTTTATTGAAAATTGAGAAAGCGGAGAAATGGGTCTCCTCTCATTGCTGGCT
GCCTCGGTTTCATATACCCCCGCTCCCTCACTCTCTGGCTATGCACGCGTGGCCTAGTGG
TGTGTAGTTTCGGGCGACGCCCGGCATGCCACGGGTTCGATGTGCGCGATGAACTCTTTA
CCATCTTTCGGGGCATAACACTCTTGATGATAACATACCCATTTGCTGAGCGCTTTTTTG
CAAATTTTCTTTCAATTTCAAAGATAAATCACTTTTATTATTGCTGCCATGAATAAAATG
AAGATTAGGATATATTTTTACGTGTCTGAAACAATTTCAGTATTTATGCATCGAATTGGA
TGAATTGAAATCTTGTTGCCAAATTCTCGAGGACTCTTGTTGGTCTTGCAGAATAATTTA
CCTAAATTCTTCTTTTTTTGAATTTCATCCTAACTGTTAACTCACTTCTGACATAATTTC
GGTATTCGGAAACTATCAATATAAATGCGATGCTATCAAAAATTGGATAAATTCCGATTA
AAGTATACAGCCATCCAGTTTTCCAGTTGATCTCCATATCAATATAAGGTGACAATAGAG
TTGTCAGAAAGAAAGGAGCAGATGGCAAAACCAAAAATAATGTCGGACCAACGGTTTGAG
CAACAAGTGCTCGAAATATTTGGGATTGAATTTTCACCTGACACGGCGAGAAAGTTCCCA
GTTTTTCTTTGATTTTGAAGTGCAATTTGACACCGAAAAATATGACAATGAAATATTGAA
AACAAAGAACAATTCCTGCTGCTATAATAAGGGAAAGAATCTCCCATTGTATAACATTGC
TTTCACTATAAAGAGCCAAGGTATATCGAGCAATTGCCGAAATTTCAAGATCATAGTTTT
CTCGTATAACTTTTCTGAAAATTAAAAAAAAATTAAATGCAACAGTTTTTGGTTTATCGA
ACAACGATACTATTCTAGGCAACCACTTTTGATAATTTTTAGGTACTCTTCATTTTAAGT
TGTTTACCTCAAATAATCATCAGAAGTATCAGTTGGTTTTAGCAGCTGATAAAATGCAAT
ATTAAACCCTGCAGCTGGTATCAATAAATAAGAAATCCAGAGTACTGTCCCAAAACCGTC
GAAATATCTGACTTTTGCGGAATGAAAGAGACATATGTAGCGATATAAAAATTGAATTCC
TATGAATGAGATTATCAGGAGATAAAAAGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved