Caenorhabditis_elegans Locus Mono:10:C04G6.12
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:10:C04G6.12
Caenorhabditis_elegans
Mono:10:C04G6.12
II
C04G6.12
1001..1075
2075
TATTGATAACCTCTTCTTCTGGACTTCCCAAATAATAAACAATCATTTTTATCTGTGAA
ACGGAATCTTTTCCAGGGAATAGCTGACGTCGAAGTAGCATTTCAGCAAATATACATCCA
GCTGACCACAAATCCACTCTAAATTACAAATTAGAATTTTTATTTTCGAACATTTTTTTC
CTCTATTACGGGAACAAGTGAAAACTACAGTAAGAACTCAAATAACAATAGATATTTAAG
CTCTTTCTGTAGTTTTCGCTAAAAGATATCGCGCGTCAAATAAAATGCACCAAGTACGCA
TTCTCATGATTTATTGTTCCCGTAATATAAGTATTTCACCCATTGTTGAACTTTGACGGC
TTATATCTCTGTTGTCGTTGGTTTTATTCAACAACTGTCAACTAACAAAATATTTGTAAA
TTCTTTTTCTACCGTTTTGTAGTGAAGAATTTATTAATATCTTGAAAATGAACCAAGATA
TTACCTTTGAAAGTGAAGTAGTGTGGTACAATACTATCAGAGGAAATACGGTATTATTTT
AAACTCACTTTGTGTCATATTCTACCATTGAAAACAAAATCTCTGGAGCTCGATACCAAC
GTGTTGATACATATTGCTGCACAAAATTAATTGAAATGTCATTATTTCAAGAAGTTAGCT
TACTGTCATATGTCCTCCAACATTAGCGTCATCTCTTACTGTACTCGCAGAAGCATAAGC
TCTTGCCATGCCAAAATCGGCGATTCTCAGTAGACAATCTCCATTTAAAAGTAGATTTGA
TGGTTTTAAGTCTCTATGAATAATTCCAGCAGAGTGAAGGTACTGAAAGTAAACTTTTAT
TTTGCACAGCAACTGCCATCTGCGCTATGCTACACAATCTCTTCACTTCATACTCTCGCT
TTTTCATCTACACCCTTTTTTCTCACAGGTTCTCTGACATGTGTGGCCGAGTGGTTAGCG
TGCGCGCTCTACGAATTGAGTGCGTTAGTTCAACCCGCTCGCAGTCGAGGAGGAAAGTTT
CCATGCACCACTCTGAAGGATAGTGTGGATTATGGTTCACAATTTACTGAGGCTGTTTTG
CTTTTTTTTCTTAATTTCCAGTTTTTAATTCATAAAAATTTACCTTCAATCCTCGAAGTA
ATTGATAGAAAAAGTATTGAAAATGTTGTTCCATGAGAGTCTGTCTTGAGTGGAGAATCT
GATGAAGATCAGTTTCCATGAGATCCATAACTAGATAAATGTCCTTTCCATGAGCGCCCT
CTGCAGTGAACATGTCTAACACAGCGATGATGTTCTCATGGAGCAGCTCACGAAGAATTC
GAACTTCTCTCAATGATCGTTTGGCCAAAGTGTGTGCAGTGAAGGCTCGTGGGATTTTCT
TGATTGCCACTTGTTTCTTATTTCTCTGTAATTGATTTTTCACAAGTTTTTAATTGTTTT
TCAAAGTTTAAAGGAACATACCGTATCCATTGCTTTGCAAACCACACCATAAGCACCTGC
TCCAACATTTTCCTCTGCCAAATACGGTGTTCCTTCTAACCAAAACCGACCGTCTAATCG
AGCATGTGACTCTGCAGGAGCCGCCATTTTACTCTGAAATATTGATTTTTAATTAAACAA
TTTCTATCATAATCCACGAATAAATATGTTGTGTGGGAAAATACTATTACCTTATTGACA
GTGTTTTTAGAAATTGAATATGTTTTGTGCTCTATAATATTGGTGGAATAATAATTAGGT
GCTCTATAGAGCGTAGTTCTCGCACTCATTTTAATTTTGAAAAAAAAAGAAGTTTAAAAT
TATATTTTGTACCCTCTAATCCTTAGTTTTATATGAACAGAAAAAAGGTGTGGCATGTCA
ATTACAAGGTTATCAAATATTTGTTTTTGATATGAAAATTTCAAGAATGTTTCGTGCTAA
TTCGCACAAAGCACGTCGAAAATAGGAAAAAAGGTGCATACGTTTTCAGAAATGACGGGT
TGATGACGATAAAGCTTCAACAGTACGTCTTATCACCATTTTTTCCCTTTCGGCTCCTCT
CTCTCTCACGTTATCAGATTGAGAAAAAACGAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved