Caenorhabditis_elegans Locus Mono:17:K07C10.2
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:17:K07C10.2
Caenorhabditis_elegans
Mono:17:K07C10.2
II
K07C10.2
1001..1087
2087
GTCCTGCACTTCCCCTTCCTCTAATGATTTCTTTGTCAAAACTATTCCCGTTTGGAATG
CGATCACTACTAATTGTAACTCTTTCCTCTCTCCAATTTCCTTTGAACAACTTCTCGACA
ATTCTATTAATAGACTTTAAATTATCCATCTCATGATTATTCTTCCCACCCGGTGCTTTC
TTTGTATTATACCGAGTCATATTTTTGCTTTCCCTCCCACACACTCGAGTATGTTGCCCC
CTCTCTTCTCTTTTATTTTATTCTTTTTTTTATTTTAGGTACGGCTCTTGCGGGCCAGCC
TAAATTATATATTTATTGACTTTTCATTTTCTTTTCTTGATTCAAGTGTTGAAGGAGAGA
CGCAGAGTCTACACGGCTCAGCGCCCTCTCCTCTATTTCTCCGCCTCTCGGCTCGCTGCC
TTGAAGGAAAGGGGAGACCGGCAGTCAGGAGTGGGGGCATGGCTGGAGCCACCGCTCCTG
CACTCTCCTTTTATCTATATTTATTCTCTATCTTATATTTATACTTTTATATATAAACTT
ATATTTAATCACTCATAGTCAGTTAGTCTTTATTAGATCCGGGTCCAGGTTGCATCTCTA
GGGATGCGAGACATTTGATAAAGCATATGGTCCCAAAGGAAGGAACGGGCCCACCCCTTC
CACACAAGTCAATAAACAAACAAACAAATAGGAAAAAAATATATGCCTTAAATTTGAAAT
TCCCCCTTTCGCGATATATGCATTACGCATACATAATGTACACATCGCGAAAATGGTCGC
ATTTTGTTCGCGATGTATACTATGTGTGCGTTTGCGCTTCGCTGATGTATGATTTATGCC
TCAAAAGACACAATGTATACCCCGCGATTTAACTGTGATAGTCCAATAGACCATGTTGTG
ACTTGGGCTAGAAACAGACCAAACCTACGTAAAACTCAGAAAACAACTTTAAACTAAATA
ATTAAGACTTCAGGGAAGCTTTCCAAAAATTTATCGAGAGACAAGAGCTCAGACTAAGGC
GTACTATTTTTCTTTTCAGCAGACCGAGGCCCTCCAAAGGTGTCCTAAGTAAGTCATCAC
AACTCTTGCTGGTGATGGAAGTGGGAGCGAGGTGATTGAGCGCCGCGGCCGACACTACGC
GGGTTCGCAGGCGTGCCTAGGTTGTGTGTAGGGTTGCCCCGCCCACAAGATTGCAGCGAT
CCATTGTTTTTTGAAGCTTGTGGAGAGACCAATGGGTGGATAGAACTAGCAGAGAGCAAT
GCTCGAAACAAAGAAAAAAAATAAAATTTGTTTGAAAATCGACGAAAATTAATAGGCTTT
AGTTTTCCAGATGCTGGACCTGAAGCGGAGAAGGCAGTAAGAATGAACATGTGCAGCCAA
GGATAACGAAAAGGAACAGTTAAGTTGTATATGATACATTATAATATTCTTTGTTCCATT
ATGAATAAACCATTGATGAATAAATTTTGATATAAAAACAAATTTTATTATATTTTTTAC
AGAAAAACAAGAAAAATTAAACAAGATTTGCCCAGTTTCGACCATTCCCACTAGACTAGG
ACTTAACACAAATTAATTTTACGGAGAGAGGGCATGGTCTCATCAGTAGTGACTCTCTCT
CCCGGATGTTTCGCATTGATTCGTAGATTTCCCAATGTTATTCATGTATGTTTGATTCTT
ACCGACACAAAATTGCCTGAATCAACAGAAAAACACGAGATAAAGGGCCAAAATCTGCAC
TAAAGATCATTAACTTTATAAGATCTGTCTTCCACCTGCGGTTTCAATGGAAAGTTGGCA
AAATTATTGTCAAAATTTGTAAACTGACATGTGGAACGTGGCTTATTTTTTATTTAAGCT
CCTCCCATTTTTTAAAATAAACTAACAAATGAAAATTTCAACCAAAGGTGAGGAATGGGA
GGAAATTTAATAAAAAACAAAATAAAAAATAAGCCACGTTTTACATGTCCGTGTATAAAT
TTTGACAATGACAGTTTAGGGTTTCTTTCGGATTTTATCCCGCGAAAAAAATTTTGTGGG
AATTTTTGAGAAGGATCCTTATGAAATTCAATTGTTTTGTAAGAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved