Caenorhabditis_elegans Locus Mono:16:T10B9.11
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:16:T10B9.11
Caenorhabditis_elegans
Mono:16:T10B9.11
II
T10B9.11
1001..1071
2071
ATTCTTCTGGAAGTTGTGATGACGTCATCAACAGAAGTTTCAAAGTCAAAAGAGTTGGA
GAATTTGGTGGAGGTGTTGAGGTGTTTCAAAGATTTGAAAGAGAGGTAAGATTTCAGAAA
TTTCAAAACCGTATTCATTTAAAGGACCATCGAACTTTTAAAATCCCATCGTTGTTTTTG
TCACGAGGTTAAGAAATTCTTTAAAAATCTCAAGTTTCTTCAATTTCAAATGTATCAATT
TTCAGTGGTCAACGGACATACGTCACTTATATCGGAAGCCAAATGCGTCTTTTTGATGAT
CGAGGTTGGTTAAACTTTTAGGATTCCAAAAAATCAATTTTTTGAAAGCTTTATAAAAAA
TGAAAAAAAAAATCATAAGTGCAGACCGTGACAGGTTTACAGTTTGATTCAGCTACTTTT
AATTCCAGGTCGCGAAGTATCGTGTGACGCAGAAAAGCAACAGGAAATCCGCCAACGATC
CGATCGTCGATGCATCTTCTCACCGATTCATTGCCTATTCGATAGACGATTGCAAACGGC
AAAACTTTTGCGATCAGGGACCACGAAGAGACTATTCGGAGAAAGAAGGAGGAGATAATC
AGATGATGTCAAACATGAATTACAATTATAATTATAATTATACTAATAACAATTTGTTCA
AACAAAGAAAACAGTGATATATCAAACGAGATGTGTTTTTGAAATAAACTCCAAAAAAAG
TAAATGTTTAGTGAATTTTCTGTCTTGGTTGGCTTTTCATGGTAGCACGAAGGTAGGTAG
GCACATCGTCATGCCTACGGGCTTTGAATGAAAATGACTCAGAAAGACAATTGATTTTCA
AAAAAATATGTATACATCTACATACATCATATCATCTGCGCACTCCGCCTAACTTTTGTT
CTATATCTACTCATTGAGAGTGCGATTTCTGCCGACCTCGGTGGCGCAGTGGGTAACGCT
GTTGACTGGCGGTTTGCGCTGGTCGTGTTCGACGCCTGGACGACAATGATAGGATAACCT
AGAGTCTCTGAACCATTTCGTGTTTGCAAAAACAATGCTCCTTGTCTGAGTCAGTCCTAT
TTTGTAATTTTTATTTTGTTTTCTCGTTTCTATAAAGTTTTCAAATTTTCAAAATGTTCC
CCAATTGAAAATCGTATGTTTCAATATGAGTTGTGAAAATAAATTAAATACGTTTGGCTC
AAAATTACGTCATCTCACTTAACAGAAAAATCCCCTCAAGTCTTCTCTAGAGAAAGAGTC
TAAAAATAAGATGATAAGTTGTCCTGAGACGAAGGAATGGTGAGGAATAGAGAAAAAAAA
AGACTTTTTGTTGTGACGCGGAAAGAAAAACGGAAAAAAGGTTGGAAAAATGAAAAACAA
GAAGAGATCTCCTACACCTCCACCTTCAACCTTATCTCTCCGGCATATCCCCAACTTTTT
TGTGCAGTTTTCCGTTTTTTCCACAACAAATGTCATGTGTCGTGTGATAACCCGCCTTCT
GCCAAGTGTCTTAGTATCGTTTGCCATTCGATAAGCTCAAGACATTTTTGCGTCGTTTTT
GAGATTTTTGTCAAGTTTCACTCTAATTTTCAATAGACTTAGATTGTAATTGGAAAGTGT
GCCAAATTTTTGGCATTTCGTCAAAATTAGAGTTTTCTGATCGCCACGTGGTTCCTTTAT
GTGATTTTCCAGCGCATTTTCGCTGCCAAACTTCCTGAACTTTTGGATGAAAAACATCAA
AACATCTGTATCAAATTGCTATTTTTATGTATTTTTCCAACACATAAATCACACCAACTG
CACAAAATCACACATGTTTTACTTAAACCCAATTTTTTCTCCTTTTTTCCGCTATCGAAC
TTCACAATTTTTCTATATTTCTCAATTTGAAGGATGTCTCTGTTAGTGTCTTGATTTCCA
AAATGTATTCTAGATCATTAAATTTCAGCCACCTCAGAATGACGTACGAAACGATTTCGG
TTCGGATGAACCGATCTGACAGAAATATCCGCTGGGGGTTCTCTGTTCGACAACAAGCTG
ATGGATTAATTATTGATCGGGCAAGTTCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved