Caenorhabditis_elegans Locus Mono:30:Y55F3BR.9
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:30:Y55F3BR.9
Caenorhabditis_elegans
Mono:30:Y55F3BR.9
IV
Y55F3BR.9
1001..1078
2078
GCTGCTCAGCCCTGCCTGGTACCTGTTGGTAGGCAGGCACAGTCGGTTTGCAGGCTTTG
TTGTTATAGTTAGGTAGGTAGGCCGCTATAGGCGCTAGGTAGGAACTGTAGGTTTACATA
GGCGCTAGGTAGGCAAGTGCTCTAGTTAGGCCAAATTTGAAAACTTCGACTGCGTACTCC
TCTTGGGCAAGTAAGAAATGTTGGTTTTTCAAAATATCTGGAAGAATGTAGGGCTTGTGT
AGCTTGCCTACGCCTGCCTTGTGCACAGGCTTCTAATTTCCCCCCATTTTGCAAATGGAA
GAGGTGGCCGTGAATAAAGCGAACCTCGACCGGGGGTCGCGAGCGCGCGACAAACGGGAA
AACTCAACGAAATTTCGCATTTTAAATGAAATACAAAATCAAACGAAAACGTGTTTTGAA
ACCGATAAAAGCAACGAAAATGCGAAATTTCGTTGAGTTTTCCCGTTTGTCGCGCGCTCG
CGACCCCCGGTCGAGGTTCGCTTTTTTCTCGGCCACCTCTTCCATTTGCAAAATGGGGGG
ACATTAGAAGCCCGTGCTTGTGCCTACATATATGACTATTGTCAGTGGCACTGTAGGCTG
GTTTCGGTGGTTCTTTAACCTCATGAAAGGATATTTTGAGTTGAAAATAGGTTCATACCA
GAAAAAAGAGCAGAATTTTCAAAAAAAAAAAATTAGAAAAAAATCAAGTTTTTCATATTT
TTCCCTAAAAGAGCCAATGTTTTCGAGCAAAATGCAATTTTTACAGCTAATCTTAATGTT
TTTATCAATTTGCTTGCTTCACATGTTCCCCTCAAAATAGTTTCATTTCAAAAATGAGCT
TTTCCACTCATAGTTTCATTGAAAATCTCCAAAAACTATAGAAAATCATTGCAATTATTT
TAGAGGCGGAGTCTCTCCCCACACAACACACAGCGCACCGCGGAACTCGGGAGGTGTCGG
CCGCCGCGCCGACACACTCCAAAGTGCAGCGCAGTGAGTGACGGCTGTGATGATTTCCTA
TTGCCGTTTACCCGTCTGAGGAAAACCGTGCTTGATACAACTTGGAAAAGGCTGAGCCGA
GCTTTTGGATTGAAACAAGAAATTTTTTGACTAAATAGCCGCTTGTGGTGTAGTGGTTAA
CGAGTTAGTTTTTTGGGCAAATGGTCGCTGGTTCAATTCCTAAATAGTTACCTTGTCTGA
CCGCTTCCACTGCTGCATTTCGGCAACATTCCCATTTGCGGTGGCTTTGAGCAAATCGAT
ACTGAAAACATATTGATCTTTCTCGCAAACATTCGCCAGAAAGTCGATACCTTTCGATGG
ACAGCACCTTCTTTGCATCACCCCGTTCGCCTCTACCACACTGCAATCATAGCCAACTGG
ACACGGCTCGTGTGTCGAGCACGAGCGGACTTTTGAGTTGGCTCGGAGCGGGCTCCCGCC
GTTCGGACAAACTGAAAATTTTGAATTTTTGGCGGGAAAAACAAAAAATAGGTCAAAAAC
TCACTAGCAATTTCGCAATAATTTTGGCATTTTTCGATTGATGGGAAGTTGTTGGAATTG
CCGTCACATCCCAGGAATAGGTAGGATTGGCACTCCTGGAATGAAATAGGGATGTGTAGT
CCTCTCGGACTAGTAGAGAATTGTCGATTTTTTGTACTCCTCTCGGAAAATGGGATTTTG
AGATTAGAAAATTTTTGGGAATGAAAGAAAAATGTTACAATTTTATAAAATTAGATCTTT
GTAGACCTCTGGAACAAGTGGATAATTATTGATTTTTCGAAGATTTGAGCGAGAATTCAA
CTTTTCTCTGTGTACTTCTCTAGGACAAAACACACCTACCTTCGCCTGATTATTGTAATA
ATATCGATAACTGGAACCGGATCCGCATCCGATTCCTTTATTCACTTGCAGAGAACACGT
GTAGGCTTTGCTGGGACAACATCCATACACCAAACCGTCAAAAGTGCACTCATAGTTGGC
TGGGCAGGCTGTTCCGCCGAGCCCCTCGCCGCATTGCATGAATTTTCCAGAAAAATCCAC
GTAAGCACGTCCTTGTGGGCATTTTGGTTCGGCTGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved