Caenorhabditis_elegans Locus Mono:35:C46C2.8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:35:C46C2.8
Caenorhabditis_elegans
Mono:35:C46C2.8
IV
C46C2.8
1001..1073
2073
TCCCTTTGAATAATAAAACTGGAACAAATATCTTTCAGACTCTTCAAAATTCAAAGTTT
AACAATGTTGATGTACTGTATGACAAGGATCTCATGAAATCTCTTTTTGGAGACTTGAAA
TCTATATCTTTATCTATAAAATCTTCCAACTGTTCAAGTATGATATTTGCTAAATATCTA
CTCGACGGAACTGTTTTCATAGGTGATAACATATACGGAGAAGCTTTTAATTGCTTATCA
AAGGTACGTGATGCTTTAAATCTGATCAACGAAAATTAAAAAAAATATTTTTATTGGAAC
CTTCAAGAGACTTCACCTACCATCCCTCCCTTTTAGAAAAGGATACTAGTGCAAATAAAA
TATAACTCTGAATTGCAGGAAAATCTGGAATCATTGTTCATGTCGTGTGCTCGTGAAATC
ATTCTGAACAATCAGTCAATCGACATACTGGAACATCTCAAGCCTGTTTCACGTTGTGTC
GCTGGAAAATTGGCTTGCTCCAAAATAGACAAAAACTCATTCATTGGAGCAGTTTTCGCA
GGAGTTGACCTTTTTGACACATTTTCAAACTCTCGTTCAATTTTAAGTCAAATTAAGGAA
AACAAGATGAAGCTTGAGTTCAATAAGGAAAAATATTATTCATATTTGAACTAAATGAAC
ATGTTTTTGATTGATTCGAAGAAAAAATTAAGTTTCAAGCTGTTATACCCTATAGGGGAA
CATCTCGTTTTACAATCCGAAGAGTAGTTATTGGAAAAATAATTCTGACAACGAAAATGT
TCTAATTTCTATATAATTTTGATCCAATAGTATGATCCAGTATTTGTAAAAGGATACGGC
AGAATAGGCTCTGAAGTGTCAAAAGTGGCGTAGAAATACGACTCCCACAGCAGACCTACC
TTGTGTTCATAAACGCCCTTTGCAAAATCTCAACTGTTGACACCGATGGCTTTGCGGTTA
ACGCTTTCGAGTGTCGTTCTGCAGGCCGCTGGTTCATTTCCCTGTGTATGACGACAACGT
GTTAGGGACATCTGCACCAACCGTGAAGATTTAACGAAAGTAGTACTGACACAGTATTTT
ATTTTTGGTTTTTTGGTATTACGCCTATTTTTTTTAGAATACCGTTGCGAATTTTTTATT
ATTTTAACAGAAAGCAGAAGAGTCATATCATAAGACTAATTGTAAATATAATCTTTTAAA
CATATAAAATGACTACAGAATGACATAATACACAATTAAAACAGCTAAAGAATTTAGAGC
ACGTGGGTAATTTGCAGAATTGGGTGATTTGGTCGTCGTAGTCGAATTCAACCACTTTTC
AATATTTTCATCAACTATTTTTCGTGCGGTTTTCAAATCAGGAAGATCATCTTCTGTTTC
TGAATACATATCTACACAATGAGAAGTTCCATTAATTAAAAATGAGACAACTGATGGATC
AGTTGAGTTTTTTAGTCCAAGTGGACTCCATGGATCAGCATCTCCATTTAGGAAAACTAC
ATTTGTTGCCTGGAATTTGTGGATTTGAAATAAATCACACGAAACAATGAATTGGTTGTG
AATAATTTTCAAACAACTTTTTGTACTCACATTGAACTCATAAGTTCCATCGTACTTATG
ATTTGTCCTCCCTACTTGTTTATCAATTGTTGCTCGTGTGTAATTATTGCCAAACAGATC
CATGCATTGTTGCACAAAATAACTGAAAAAACACCATTTCACCAACAATCTATTTTTCAG
TCTAATTTTTAATTTTTTGTTCCAATTTCACACAAATATAAAGGAACACAGCTCGTAGAA
AAATAAATTTCCGCAAAACCCGAATCAAAAACTAACCTGACTGGTACATTTCCAAAAATA
GAATTTCCAGTGTCAGTGGATTGATAAAACCCGAATTCTGTACATGTTTGCCACATCCAA
AGTAGACCGTCGTTTTCAGTGGATATATCATCGTTTTGGTTGTCTACATCACCTTTTGGT
TTGTTCTTCAACTTCTGTGAAATGCAATGCATCTCTCACTTGAAATATATTACACATTTC
TGCAACCTTCGATGTCTTTGCAAATGCACCACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved