Caenorhabditis_elegans Locus Mono:11:C18A3.12
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:11:C18A3.12
Caenorhabditis_elegans
Mono:11:C18A3.12
II
C18A3.12
1001..1065
2065
GGGCTGGATTTCTCCATCGCGATATTAAGCCCAATAACTACTGTCTGGATGCGAATTCT
GGGCAAGGATTAAGAACTATTTACATAATTGATTATGGTATATGTAAACGATTTGTGGAC
AACAATAACGTTATCAGACAACCAAGGAAAATCACCAAATTTCGAGGAACTCTCGACTTT
GCACCGATCGTCAGTCACGAACTTCGTGAGCACAGCAGAGGGAGCGACTTGGAATCTTGA
TTAGTTTGAAAACAGTGGGCTTGAAGTTTTGTAGTGGCATGATAGGGGTTCACTTGTGAT
ATTGTGTAAATAAATAGATTCTTACTCGAAAAAAGTATTTCCCTAGGTTTTACCTCCTCG
CCTACTTCACCGTCGGGAAGCTTCCTTGGAGTTTGCTGGAAGATCGAAAGGCAATCGGCG
ATGCGAAAAAGCGATCCAGCGTTGAACCTCACTTGCAAGTGCTTCTGCCTGGATGCCCAT
CGGAGTACTTTCAAATCTTCAAGTGAGTATTTTCAACAACCTATTTATTAATTATTTTAA
TTTTCAGGTACATTCAGTCTCTAACGTTCTTCGCGGAGCCCAAATATGAGGATATTTATG
AGAAACTCGAAAAAGTGATTAGTGCGAGGAAGTTGAAGAACTTTAAGTTTGATTGGGAGC
ACAATCCAGCTTTTATGGACGCAAAGTAGTTGGAATGACTACTACACATTGATAACTCCT
TGTATTTTTCATAATTTATTTCCACAATAAATCAGTTCAATAATGATCAACGGTATTAAC
TTTGCAAGCTTCGAAGTTCAAATTTTTAAATTACCATTTTCTCGTTCAATTTTTTTGGTG
GATTGAGAATCCGACAAAAATCTTCATCGAAATGACTAACTTTTTCCTCGGTTCTCTGCT
GTGGGCGGAGCGAGCGCGCACACAAGAAGTGTCACGCCGCGGAACTCGCTAAGTGTCGTC
TGCTTCCCTGCAAGACCTCATGAAATAGTGCATTTGGCACTGGCAGTGATGATCACAAAT
CCGTGTTTCTGACAAGCGATTGACGATAGAAAACCGGCTGAGCCAAAAAATTTTGGAAAT
TAAACCTGAATTGGTTTGCTCTTTGAGAAATAAACTTCAATCCGAATACTTTTAAGCTTA
ATTTCAGATTTTAAAGAACTGTAAATTCCCTCGACTTGCAAACACTATTACACACAACCC
AGAAGCCTTCCAGTATTTTTTTTCTGTCTCCAACCACTTGCTGACTCATTGCTTTTGTAC
AGAAGGACACGAATAAAAAAGGTGTGGACCGGCTGTGACGTCGACGTTGCGGATAGTTTC
TGGTGGCGGGAAAAGCAAACAAGGAGGACGTAAAGTATCTCTTCAACGGTGACCAGTGTG
TAGATTTGAATCAGCGTGTGCTTTTTACGAATTATCAATTGTTTCCAGCTTCTCTTTTCT
TGAATCTTATTGTTCTGAAATTGAGTTTGTATTTTTTGTGTACAACTTAATATGACCTCA
ATTTTTTAAGGAATGTGGAAGAAAGGTCAGGACAAAAAGATGAATAAGTTGATAAGGAAA
ACGGAATGTGTTTTTTTGTTTCTCAATTTATATTCTTCAAAACAAATGTGCTTCTGCAAG
TTTTTATTATCCGGTTGCGAAACAAGGCAAATTCACACTTGAGAGTACGGTAGAGGGTCT
CGACACGACCGAGATTAAAATAGTCACAATTTCCTTTGATTTTTATTTTTTTTAATATAG
ATTCGGCTATAATTTTTTGGGGACAACTGCACTCCTCGGCGGTGCACTGTTTTTTTTTAA
TTAAAAAATATTTGGTCGTGCTGAGACCGGGCACCATTCTTCTACTTCATAAATGATAAT
TGGACAACATTTAAATTTATTGCAAACACTTTTTACGTGACAGACACTTCCAAAATATTA
CCCCCAACGTTTTTTTCTTTCAAAAAAATTGTTTCTAATCTTTTAGACATTCCTCTCAAA
AACTCAATACTTTTTGCAACGCTCTCTCTCTTTCTCGTTTCTAGCAAATTGCAAACATTC
TTCATGTCATTAAAATCTCATAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved