Caenorhabditis_elegans Locus Mono:12:K02C4.8
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:12:K02C4.8
Caenorhabditis_elegans
Mono:12:K02C4.8
II
K02C4.8
1001..1135
2135
CATTTTACATCATTTACCAATCAGACAAGGAAGTAGAACATATTAGGAAACGATACCAG
ATTATAAATATAAAGTATATTTTGAAATCAAAAATATATCATGTCAGGCAGCTGATCGAG
ACGAAAATTGGGAAGAATATTGATGGGTACGTACGCAGTGGGAAAATCAAAATAACTTTC
TGACCGATGCGATCTATGTTTTTAACGGATGTTTCGAGTTTGAATTTCTAATTTTTGAAG
GTTGAACACAGAAAAACAATCAGCAATGTGGAATGATTCGATTTAAAATTCATGCGGATT
ACTGGAAATTGATGGAATGTTGTTTTAAAGAATCGCACTTAATTTCAAAGCGAAGAAGTT
TCCATTGTTAATGGATTATTATGTAAGGTTTACACAAGTGTCTGAAAACACACTTGCCAT
TTGGTCGATTCTATACCAATATGGGTTATTACCCAGACGATAAGTTTTGAAATCTTTGCG
CCAAAAATACGGTACCCTCTCTTAATACGCTTTTTAAAAATATATATTATAATACAAAGG
GATGTGCGCATTTAAGGGGTACTGTAGTTTCAAACTTTAGTTGCTGCGGAATTTTTTTTC
TTGTTAAAAAAATATTTACTTATTCATAACTATTAATAACTAAAATGAAATTGTTAAATT
TTTGACAAATCGTGGGAAAAACTTTGAAATATCGATGAAAATTCCACAACAACGAAAGTT
AAAAATTACAGTACTCTTTGAAGGCACATACCTTATCGTAGTTAACATAAATTGTCGTAT
CGAGACCGGGTAAATACCGTGTTTTTGGAGCAAGAATCACAAAATTGCACAAAAAATTGC
GAGCATGGGTAATAATATATTTAGCCAGCAAAAAAGTAAAACACTACATGTACCCCAAAC
ATTGCTAACATGAGCGTACATTTATACCGATCTAGTTGTTGAACCCATGGCCTATTGGCT
AACTCTGCCGTCTGCCACTCATGCAACGAAAGATCAACACCGCGTGAGTACTGGCTGTTT
GTGTCTCCGCCATTGCCAATCAGCTGTCATTAACCACGCAATACCGTACAGAGGTGCTAA
ATTACCGTGAAAACCACTTTAAAAATTGGTCACTCGGAGGAGGCACCTCAACATTTTTCA
TTTACCTGGGATGATAGACGACCTGTTTTTTGTTTTGTCTACCTACCACCCGCCCAGTCG
ATTTGAACTTTGCAATTAGGCACGATATAAGGACACGAATTAGACAGTAAACATGTCATT
CCATTTTCAAAGATGCGAATGTTAATCGTCTTGATTTTTTTAATTCCACTAATTGACTGT
GAAGCTATCAAACAATGTCTATGTAAACCTTATGAAAAATGCCTGAAAGCGGCACGAAAG
GAACCAGTTGAGAAATGTCTTGCTAAATGTGAAGTAGGTGTTAGTCCTCATATTCCAAAT
TTTATTTATATTTTCAGAAAATATTCCCTACATGTGGATTCGTTGGTTGTATGAAACAAT
TTGTACCCGAATTCAACCGAATGAAGCAATGCTCGTACTCTAGTATGTATGGTTTTAGAG
GATGCACATCCCAAAAATCAAATGTTTTGAGTCGAAGAGGAATGGATGAATTTCGTGATA
TTATGATATCAACGATTGAAGACAAAATTGGAGATTTTGGTATTATTGTGTTTCATTTCA
TCTTTAAAAATATATATAATCCAGATGAATCAAGGCAGTTTATGAATAAAAAAGCCGCTC
GTCAAGGAGAATGTGTATTTGAATGTCTGTATCCTGGTAGAAATGCATGTACTCGAAAGT
TGAAATGTGATCTTTACTTGCCACCTGAAGACGAATTTTTCAAAACTTTCTATTTGTGTG
CTGAGGAACAACGATTTTTCAGCAAATCTGAGCAGATGTATGCTTGTATTTGTAAGTTTT
TGTTTTATCAATTTGAAGTCACTGTAAGTTGAGGTGTTCAAATATAGGCTAAACTTTTAA
TGTACTCTGTTTTAAATTAAAATAATTAAAACATACCGCATGTCACTTTGGAGAACTGCC
GTCTACCGCTATTCTTCAAATCAAATTTGAATAAACACAGTCTTCCCTACCTAGATTTTA
TATTCAAATGTTTTGATATCTTTTTTTTATATAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved