Caenorhabditis_elegans Locus Mono:7:ZK265.10
snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Mono:7:ZK265.10
Caenorhabditis_elegans
Mono:7:ZK265.10
I
ZK265.10
1001..1062
2062
ATTATTCAGACAATTCAGACTTCAACTCAGCGAAATGATTTCAAATTTGAATTTCCGCT
TTAATCGCAAAAATGAGTTTCTAAAAAATAGAAAATTAAAAAAAGGGTTTTCTTTCAATT
CACAGATTACTGTAAATTCTTTTTTACTACATATTTGGTGAGATATCGAAGGATTCTAGA
CTTTGGACTGGTGTCCTTTAAAAAAAGAAACTCCTCAAAAACCGCAACATTTAGGAGGTT
AAAACTATAAAAATGCAAACAAAAAATTGGACGAAGCCAATGGAACGAGTGTTCTTTTAA
TAATAATCATTCCATCTCCATTCTCTCTCTCTCTCTCTCTCTCAGATTTCCTTCTCCTAA
TGTGTGAGAAGCCACGTGTTTGCTCAGTGGGCACCAAGTTTATTTGAGGGGTCCAAACGT
GTGAATGGCTTTTTGGCCCTTGTGTATTGACAGATTATGTGCACTTCTCCGCTTCCGATT
ATTGTTTACCGTGTAGTTTTGTTGATATTAGTTGGACCATAATGACCTCTGAAATGATTT
AAGCCTGGCATGGGAAAATTGGAAATCCGATATATCTAAAGAATTTTAATTTTTTGAAAG
CTTCTTGTTGTGAGTAGCTTCGAATGACATTTCTCTGTAAATTTTTGAACCGATCATTCA
TCTAAATCGAGAGCCAAAGTCCTGGCACGAATAAAAATTTTCAAGTACAGTACCACCCGT
GTATTGAAAGAAACTTATCCCCTGTTATGTGTCATGTTTTAAATTTTGTTTAATATGGGT
CCGATAGCTTGATATGTTCAATCTTAACAAGAGAAATAGTCGGGCTTCAAATAAACCCTT
TCTTGCGACGATACAGCAATAACCCCTCTACTTTGGACTGCTGACTGCCACCCGTTTTAT
AAAGACCCTTTGGACACTTTCCAATGCTATGCGCGCGTGGTCTAGTGGTCTCTGGCGGTA
ACTGCCAAACCAATGACCGCCGCTCGGCTTCCCGTTGCGGTGTGCAAGGATGAAAAAGAA
CTCTCTCACTGATAGATGATGTCTTCCTACATTATCAGAGCACTTTTTGTTCTTTTTTGT
TTCTGTGATATGTAAGTTGTTGTGTTTATTTTTCTTCCAATAAAAACATTTTAGGAATAG
TTTCTTGATAGCGGTTTATGCGAAAGGACACTGCGTGCGCAAGTTGTACAAGATTTTATG
ACGGCGAATATTAAACAAGACGCTCTCGCTTTGATTAGCAAATATACATGTATGTATGAT
ATTATTATTATGATATTATGGCAGAAGAGCAACACGTGTTTGCACAAAAGGAAATGAGGG
AAGAGAATCTTGATGAGATCACGAATGACCTCATTTTTAATTTCAGATTCAATGAAAAGC
CACGTGGTCGGGCTTAATGAAAATTGAAATAATGTTGATACTTAATGAAAAGAGGCGGAG
ATCACCGGATAGATTTCTGTCTCATTTGAGGTTCAGAATTCTTCGAATTTCAGACATACA
GGTGATTTTATTCCTTTTTGTATTCTGGTTCTGAAAATCGTCTAGTATTTTCAATCAACT
ATGATCAATGCTACCGAAATTGAAATCCGAGAGGATATTCACGCAGGTTAGTCTTACGGG
TTGATTGAAAATTAGTCTTGCATGCAAGACTAATAGAGAAAATACGGTAGCTAAAAGTAT
TTTCTTGAAGTAAATATAAAACTATTTTCAGATGACCTCACAGTGATGGCAATGTTCATT
AGAAATTCTCATCAAATGCCAAGTAGTATTGGTGTTCTGGTGCAAGCTGTTTTATTTATT
ATCAGCTTCATTTTCACACTAATTGGTGTTTCAACTGCAATGCGATTCACGTTAGTGTGG
GAAATTGTTGAAATTTTTTTGGCTCTAAAATAGGTCCAAATATTTTCTTTCAAAATTTTG
TTTAATTTCCAGTCAAAAATTCATATTGAAAGTAGTACAAAAATTGTTTTATACGAGGTT
CTATATTATTTATGTTTTAATTATTTGTATATAAACACTGTATGACTTCATACATGAAGG
ATTACGTTACATATCTCAAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved