Aspergillus_nidulans Locus Mono:U14
snOPY snoRNA Orthological Gene Database
Aspergillus_nidulans Mono:U14
Aspergillus_nidulans
Mono:U14
U14
1001..1115
2115
TCGATCGAACTCTTCGGCGGCGACGAGCACTTCACAACTCTGCAAGCCGACGGTGTCTG
CATCTCCACTCCAACCGGCTCAACAGCCTACAACATGGCCGCTGGCGGCTCCCTCACACA
CCCCGACAACCCGGTAATCCTAATCACGGCAATCTGCGCACATACGCTGTCCTTCAGACC
GATTATTCTGCCCGATACGGTTGTGCTGCGAGTGGGTGTACCATATGATGCGCGCACAAG
CTCGTGGGCGAGCTTCGACGGGAGGCAGAGGGTTGAATTACTGCCCGGTGATTATGTAAC
TGTTTCAGCATCAAGGTACCCGTTTGCGAATGTGTTGCCGCATGGGGGGAAGGGGGATGA
TTGGATGAGGAGTCTTTCGAAGACGCTCAATTGGAACACGAGGCAGAGGCAGAAGGCTAT
GACATAATGATCATGATAATATATGGTATGGGTTGGTTCTAGGTCTTAAAATAGATAGAA
TGGGCTAGCAATTTTGGATTGACGCTGATTACCGGCTGCGAGCCTAATATGTCTACCACA
GCGGGTGTCTTTTTTTCTCTTTCCTTTCTCTTTAGCAATGAAAACGAACTTGCGCGGCGA
GCCACCTCGAAGTATCTATTTCTGACGTATATGAATTTCAGGGAGAGTTCATGACTTATA
AAACTTCGAGTGCTTCATTGTGTGTGGAGACTGGAGCTGGATAGAAAATGCTGTTACTTC
TGTCCATCTCTAGAACTTTCGTACGCTATGGGTCGGTTTGGTTTCCACGGCAGCCTGAGG
CCTATATAAACCCACCTTTCTTTCGTGATTTTTCTTTCTTCAATCAACCTCTTCTCTTCG
CGACAACAATCAGCCTAGGCTGGGATCTTATGTGATTCCAGATACACGCTTACGATTTCT
ACTTGTTAACATATTTAACATATTTCTTACGCCCAGCTTAAACTAATAGGTAAGACTACA
CATACTTCTGTCTTCTCTCCTCGCCGAAACCAAGACAAGAGCCAGCATGATGAAACACAT
TTCCACATTCGCAGTTTCCACGCTACCAGCCGTCGCTTATGAACCCATCATAGACGTGCT
CTGAGCGTCAAGTACTTCCTTGGATGTCTGATTTGGCTCGCAATCTTGAATTTTGATTAT
CGAGGACAGTCTTTGGCTGAGCTTTTGCTAATCTGTTCGAAGATCCTAGGTTGAAAAGCA
TGCCAGAGCATGCCGCATGCGTTACATTATTACGAAGTACCAGCCGTTATTTGGTTAGCC
GAGAGACTTTTGTTGATAGCCTGAATAGCGGACATGAATGAAATATATTGTAGCAATTTG
CTTATTCCGAGGTCGTCATGATGTTGGACGTTATTGTTCTTGTTCGACCTGTCAGCAGCG
TAGATATAGGTGATAGTCGGTCAAGTCAAAACGTCTGTAACATATGTAACAACTCATCCT
TGATTCTCACTTCAATTTCCCTATGAATGTAAATGAATCTCGGCATTTAAGTTGGTGTAA
ATCCTGGCCTGTCCGTCGACCGTTCGGTGATTGGGGGGAAATGTATCAAACAGCTTCCGC
GCTTGTAGTGATCGAAAAAATTTGATCCCTGACCTAGATGTTGGGTATCCGTCTCGCAAG
GTGACATTGTCATTGAACCTTGAACGAGAGCCTGATACTGTGCATCTTAGCAGCTACTCA
ATCGAACCTATTGTTCCTCACACCGTAGGGCCATACCTAACACCGGCTCCTTTCAAAGCT
TCGCGCGCTTGACGAATCAAATAAGAGCTAGACAGACTTGATGAGAGGCGACTTCCATTG
TCATGGCTTCCATGTCTGCCCTGGAAATCCCATGAAGGGACGAGCTGCACTGGACTTGTT
CAACGGGTCTCGCTCTCGCGCGCGGAGCTCCCGGTTGCGTCGCTTACGGTCGCGAGCTCG
CTTCTTCTTCTGCCTCAAGGCCTCAATTTCTTCACGGCTCTTTCCAGTGAATAGGCGATA
GAGCCACATCATCATTGGGTTGGAGACGGTGAATGTTCCTGGCTGAGTGATAGGAAACCT
GTGATGCCAGTTCAATAACAGTGCCTTGCGGACCCAGGCACAGTAAATAGCTCATGGTCT
TGACCAAGTTACTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved