Aspergillus_nidulans Locus poly:snR55
snOPY snoRNA Orthological Gene Database
Aspergillus_nidulans poly:snR55
Aspergillus_nidulans
poly:snR55
7
snR61
1653..1741
4312
tgtatcacgaattcataggctttttaagtgattgagtacgtaacgatatgaccatactg
cattatgaagaaccacttgactgtccagcaaaccgcatcgcagattcccgcacagcctct
gcaagaacagagtgtgcacctcgcgcggcaaccacagcaccatctatcaaggcgtcgtgg
ctgagattctgatctgttgtcccaacagccgccttcgaattgtcccctttcagccaaagt
tccgtgatttcatctcgcccaggcatataggcaaccacacatgccgacagtatcgactga
tgctctgctgggtcagtatcaagcatgagtctagcacaggaatttccgtttccatcagcg
agtttgtccacgacaacggcagctacacctccggcgacaaggtcaaggcagtcaattctt
gcgtcagcaatagccgcagaagcagccgtaatacatccagctagaacattcatcattccc
catgcggcatcatgggagtctggtgcgtctccccaccaccggtcatcctcggcttcgaga
atggtaatagtgatatcaagtccactcttcggccatctctctgcgacgataacgcctctg
agcgctgtttcgaggtgtacgcctagatcgcgctcgctagcatcgcggatatgccctttg
cgcttgcgggcggcaaacggggcatatttgacgtgcgtggtgaggacgaggttgggagag
aaggtcgcagatcgaggtagaggtttagggccatggactgtgcatgcgagcttcaaggaa
gaagagggaggcgtaatgaatttaggcgatgcccgcgcagcggaaagagatgctgagggt
tcaaattcaagatatgacgacccagaggcggaagggatcaggccggttttaagaactagt
tagaatatgtaagtttcaaataccaagagcaagagaagcagtgacatacagatctttcgc
agctcatttggctgccgttgtcgttgtggtcgctctgccgcagttgcagtggcggttggc
ttgatggaggaagcgaagattggaggccgcgtgccgccaggcggcccgttgattcttcgt
ctgtcagtcattacacatgtctcagcacccgcagttccttgagcgaccgatagcgatcgt
atgagaataattaagttgaccgagctgtcgaagcagtccactcgaagcggaatctccaat
tttgaggctgtttgcaccgtttgccatgtgtggagtcggcggttagctcgaccttcttaa
gcaattttttttccgacttatttttccttttcttcccacacaagctcccaacagctctac
cttcaaaaatgaaggcagctttacagctttgctaccgcgatctatcaattcatattattt
tctactaaccatgtactgtgagttccttctattttttttcatctccctgcTTATATGAGG
AAACCGATTCCAAAAATCGTAGTTCTGGCGACAAACAAATGGGCCTTGAACAAACATGCA
TCACCATCTGATAtgcactgctcgagcaatacagtcaacagtatttgcatcgaattctgc
tgacaactgcaaaaggtaggataggtggttcgaagaggttctcggcgacatctctatagg
taagaagattcttcaccctcgctggcactatcacttgcatgatgagacaaatttttttca
gttctgcttctgcaaacttcttgaagaaaaacaaataccataccaaaaactcctgatgca
ttctcttatctctgccttgtcacttgctcaacgttgcgcttaacaagtactgacaactag
aagaaacaggacagtatggaaagttgttgcgtaaaaggtagggatctagtgaaatctcat
atccaccgcctgcaacgccttttatgatgacaactagtcaatccattcaatgatcctctt
tgaggaaccgcccttcgagcctgcatatgttgatttgattttgcatttggatccgacgat
ctatctctccgcctccctaataccggacctagttgtcactcgtttcgtcaagaagcatgg
gaacttgggaggatggttgtggagtgtaggagggtgggctcatatcgtcgtttctcgcat
tgttcaattcagctattgcttgcttgacttgtgccagctttgtcctgaagctcgttgtcc
gtcttgggtgacttgcttcttgaccgagtctggcaggggatgggatgaattaaccggctt
gcctgactacacttgatgcaagtgcgatggcgaggatattgcgtcacgaactatattctc
tggccaggaggctgacagtgcccagtgtatcattggaacggcctattgaaatcccaaata
tatagtgtgagtacacctttacaccagtttggtcgtcttcattgctctgtcctcaacctc
atgaatcatgatcaaatgatgaaatattttcggatgtaaactcacagacctgttctgaat
gcgcaaaaccatgtggatatttccgttgccttccttctgattgatcatgcccccacacag
ttgtttcatgataagaggaggaacatatggctaacctctcttagagtctcacagaatgct
agcgtgttaagtcaagatacaggaatttagtttttttttttaaccagggttttgttcatt
ctaagtagtatatatcatcgtttgtcgggacgacgacgatctcttcccatggacattgtc
gtaaatagcagtataccatttagcgcgaagcatgctcttagaccactcattcagcccgca
acactacagtaactaacctgccttaagcgtcacagaaatgacaattttaggcagcctctt
gccttcaggccacttctcatgatctctatcataaaaagaaatcataacagtttcgaacta
ggtatgtgcgggcgtcccttacgacctatcctctacctcggaacaacctgctatttctat
ttcattctacgatgattccccgattctgaagtttgcttctggtccctacgggttaattgt
atgatgggtattgctgctttagctagtatctacttcgagcccggtcataggttgttgcgg
tcaaaattgatctgacggatggtactagtctaggttcaagcaatagaacgtgtttcgtac
ttttttgtgtagcaatataaccaatatgtacatggtaaagctggcatctacacacacacc
gccatgaagccgttttatttcatgcagcctgaacctctaatcaatacatgcatagggcct
gtcttcaagtcctttttcctcttcaacgaagaaaagcaggataaagataatagttatgag
ccccgataactgcctattccacgtctaacccatatccgtctatggttgcttttcgtggtt
cagttttatcattccaataatcggtcactctttgctttcagttggtgtcgtagcgccatc
tcgagacatactgtatggggcctaggtattgcgaacagacgatattaacgatgcggaacg
ctaaaccattttgttggatttgagagggaccaaagaaagttcatagaagctggggaacgg
cttaccaagaccctctttgcgttgcagatcctccaggcgaggttgcggacgttgccatct
gagcggacgacctcaggggcgaattcgacgccgaacctagggttaagcatgttagtatcg
tttagtatacgagaggatgatggtacgcacatttgatgaacagcaaaaacaacccgtttg
gcaaatttaccatctcgctcaaccaaactaccgtactgctcttccggagtttcaggtgcg
atttccggatcccggtcaaagcagttctggatcacaggcagaaggctcgtttcgactgcc
gtttgggacatgtcgaagtgatcttcctcttcgaagcgggggatccggacttcaaatggt
cgtgaaatggccatgacattgtgcttaccattgtggtggtagcggaattcaaatacacct
tgagtccagaaaagcttgtcgccagagaaaacaacctcgccagttgcgatatcatgcttc
tccccgttatcgccttgggacgtggatacgaccacatcgctgatgaggatgccccgctcg
caggtgaggttatcgtagaagccctcgttgacggccacccatcttccttgtgaagatacg
cgggtcacctctctagaagtattgtcggtgaccttgtaaagaccaatccaatccttcttg
ctatggttgagcggtgcagtccacttgacctttactggtgtgccgtatgggaaaacccag
gttttccaagtcaccgcggcgatcgagaggtgtgcgagcgttatcaccctctt
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved