Arabidopsis_thaliana Locus Mono:JKHR07A9
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:JKHR07A9
Arabidopsis_thaliana
Mono:JKHR07A9
3
JKHR07A9
2117..2232
4349
CGGCCTTTTCTCTTTTTATGGCCCAAATCCACCGAACATAACGATTTCTGAATTGGCAC
GAATTTTTTGCCCTTTGATGAAAGAAAAATCTCGATGGGTTTATCAAAAATAAGAATCAA
GAAAAAGAAAATCAAAATCTCTCAACTGCAAGGACCAAGAAGTTGGCGTTTTTGGGTGCA
GAAAAACGACACAGCGTGTTACTAATCAATGCCAAAATATTTTACATATGAAACAAAGAA
AAGAGAGAAAAGCTTCTTAAATCTTAATCCGAGTCACTAAGGTAAAGTTCTCATGAGAGT
AGGGTAACGAGGGAAACGAATTCAAGGGTAACTCTTCCCTTTGATCTCGTGTTGATGACG
AAATGCTCCGGGTATTTTCTCAGCAGCATCAGCAAACCGTACCATGGTTTACCTTTTGCT
TCAGGGATAGCCCAGTCTTCTTGTGATAGGTATCTTCTTACTCGACTGTGATGCCATACG
TTTCCATACTCCTTTAATATCTGTCACAGACCAACCACTACCATGCATTAGCCATCATAT
TGAATCACAAAGAAGTTCATAGTCAGACTACACTAGTCATTCAAAATCTATGGAGTAACT
GACATACTTTCTAGACTTAGACACATATAAGTAGCGTAGCGCGTTTCCATTGGAAAACTA
ATTAAGGACCTAGCTTCACACTAATTATCACCTTGACATTATACAAGTCTTGTTTCAATT
GATTACTCGTACTACATTCTGTATTAGAAAAAGGCAAGGAACTTTCTCATAAAAACTAAC
CACCGAATGAAGTTTTTCCATAGGCATCCACTCTCCCGGACCACACAAATCGGAAAGCAC
AGTGGCAACAGACGATACAACATCTTTTTCCTCCAGCTGCAAAAATTGTTGATCATCAGC
TTCACGATCTACCTTTGATCTTCCCTCTCTCTTCTTCTCTGCACAAATGAAGCAGATACA
ATGTCGTGGTGTCACTAGCATTCAAATTCAATCCAAGTCTAACAAGGTTCAATCAGCAAC
CACCACAATCAAAGTCTAAAGAAACAAGCCTGATGTGATCAAGTAAGCATCATAATCTGA
AACATATCTAGTTGCACAATGAAAACTCAAACAATCATGAGCAATCTGGTTTTACCTCCG
GAAGCATATACTACTTCATGTCCATCTCTCCTTGTTTTCTTTCCACTTCCTCTCATATCG
TCCTCCTCATCGTCGTCGTCATCATCATCTTCATCATCGTACTCATACAACTCTCTACTC
CTGACGCCCTTCTTACCCGACCCAGAACCTGGACCCGACTGATAATTATGGTATGGAACA
ACACTTGTTTGCCCAGAGACGTGGTGCCTAGGTCCCAACGGCCCGCCTAAGATGCTCCGA
ACCGGTAGGAGAAAGTAGAACTCTTTGTCTCCGATCTGCAAAAGGTCTTGTGAATCGAGC
TTGACGTTAGGATTCCCAGGGAGATGAAGAACACCTTCAACGAGGCAGCCATTTTTGCCA
AGGACCTCGAGAGAGAAGCGTCGTCTAGTGAAGTCATAGAAGATCCGAGCGTGGTTGCGC
GAGATGTTCATCCCACCGCCGAGGGATGAGAGATCAACGTCGACGGTGGCTTTCTTAGAA
TTCCGGCCGAGTATAATGGAGTAAGACTGCATATAGTACTCGAAATCCTCACCTTGAAGC
TTCGCAAATCCAACCTCCACATCGCTTCCGCCACCAACAGCCGTAGCCATGCCGTGAAAT
TCTCCGATTTGATCGAAAGAGGAACCGGGACTTCCAAATTAGGGATTGCAATCGTAATAA
TTTGTGAATCGAAGCAAGATTTGTTTGGAAACTGGTTTAGCTTATCCAGGACAAAGGCTT
ATTTTGTGAAATTGACGATTATACCCATGATTTTAAGACCTGAATAAAAACCCTAATGAC
ACAACTATTTAAAACAGCCGAAGAAACATTGAGAATGGCGGCGAGATCTGTGAGCTTAAA
GGTTCCATCTCTCCCGCAAATAGTGGAGCATCTTATTGATTGTTTGAATTTTTTGATTTC
GTTTGCTTTAGAACATAGGCTTGGTTAGTTTTATGTAACCTTTTGTTTATTTTCGTTGTT
GGTTTGATTGAATAAGTTGCCAAATGATGATTGAAAATTTTGCGCAAGGGTTTTGAGTTT
CGGATGATTGGAGTTTACTCTGGTCTGAAGGAACCGTGACAAAATTATTTTCTAATAATT
CATTCTGATGGCAGCTCAATCATTGTTAGATATATCAAATTTCAATTCGAGTTTTGGGTG
CATGGTTTGATTCGGATGGTTAATTGTAGTTTGTTTTGTTAGTAGAAGCTTGGTTTTGGG
GCAGCTTAATGAATTTTAGGATTCAAGTTTTCAAATCATTTAGCCTATAATGTTCTGAAA
TGTGTTGTGTAATGGCTTTGATTTCCTGAGGATCTGACTATAGAATGTTTAAAATCCTGA
GGAACGGTGGGAAATCATGTATTTGTGTTTCTTTTTTTTTTTAAGATTCAGGTTCTACAA
ATTATGCTTAAAGGGCTTTGAGCTCCTGACCGCTTGTATTATGAGATCCAAGAAAATGTG
AAAAGTCGTTTTTTTTTCCTTTCCCATTTTGATGGTTTGGGTTGCATTTTACTGTTCTTT
TAGTTATCATGACTATGCTAGATTCTGGTCTGGACATAAGTTGCTTAAGATGTGTGGAAA
TTATGCGTAATGGATTTAGAATTGGCAATTTGTTATTTGAAGGAATTCACTTCTATAGAT
ATCCTTTAATGGCACCCGTTCATGGTCAGCTCCAAATATGCAAGAAATCGGAAAATGCAT
TAGTGTAGTCCTCTTTTCTGGTATATTGTCAATACTCAAATCTTACATAAACTTTGTTTC
AAGGACAATGAAGCATGTGGTCAAGATTTTGAGCCTGCTGGTAGCTGTCTCTGCCTTTTA
GTTTGCTCTCTTGCAGGCTGCAATTATGGCTCGTAGCCAAACATAGTTGGTTAGTAATGA
GTCTGTTGTGCTCATTTTTGCTTATTGCTATTCTCAGTTAGTCAATATTAATAATGTATA
TCTTTGCACCAGCTACCTATATACGTTGTAGTGTCCTTTGCTATTAATTGTTGGAATCGG
TTTAGTGCAGTTCCCTACCTCTCCTAAAGAAGCAGTTTTTCTGCAGCGGGTACTTTCAGT
ACTCTTTTCTTTCTTTGTTAACTCGAATTGTTAATTAAGGTTAAATTAAGTTCTTGACTA
GTGCTTTTGCTCCTAGCTGTTGTTAATGTTGATTATGTACTAGTTTGTTTTGGTGCTATT
GTTATATTGCAGGATATTGCAGATGCAAAAAGACTTCTTAAGCGCTAACGGAATTGATGT
TGGATCGGATTTGACACATTATGGTTTACTTCTTTTCAACTCCCTAACCAGTGTAATAGA
ATACTTGGAGTCTTCGATGGTTCATAGAAAGAGTTCCCATTTTCATTATGTACAGTCGTT
TACTATGTTTTTTTGAGAGATGTACATTGAGAAACCGGTGTTTGCAATTGGATTTTGTTT
TGGGGTTTTAAACATGATGAAGAACAATGTTATTCTGATAAGTTCACTTTAATTGACTTT
TTTTTTTGGAATATCGTTTGTTACATTTTTTCTCGTGTATACAATAAGTTGTGAATCCAA
CTCTTTCAAGTTTAAACTACTTGAGATTAACTTAAATGCTCCAATAAAATTGATTGAATT
GGATTTTCTAGTTTTGTTTGTTTTGAAGTAAAAAGTTGGACTTGAATGCTGATAAGTGAT
AATAAATTGACTTGCAACCATAACTGAACCAATCTAACAACATGTAACTATTCCAAGTTT
ATTATAAGCTAGATTTCTGAAATGGAAATGTCGTTTTAATTTTACATTTTTGCCGAGATG
GTTAAAACTGGTAATCATATACATTACAATTTGGTTAAATGACCAAATCTATTTGATAAC
AAAGAGAGATATAAGTTAATGAAACCATGATTAGACAAATCGACAAGCAAAGAAAACGTT
AAGCAAAAAACACTAATCATAATAAGCAAAAAGTCCATCCATGTTCATCACATGTACAAA
GATCCTCTCTGTCACTCTAGACTTTTCCTCTGTTTGCTTCTTCTTACAAAATGACACACT
TAAACCAAATAAAGAAAACATTTCCCCCAATCTTTATACATTTTCTTTTGAATTAAAGAA
AAAAATAAAAGTGATAAAAGAAGAAGAAGAAGTCCCCAGCTAGCTCCTTAAAGAAGCACA
TCTCTTTACTCATTTCACGATTCCCCTGTCTCTTGTTTCTCTCTCACTTACCTCTTCTCG
AGTTTTCTCCCATTCTTGGGTCTTCATCGA
  Untranslated Region
  Coding Sequence
  snoRNA
CP002686
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved