Arabidopsis_thaliana Locus Mono:R71.69
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:R71.69
Arabidopsis_thaliana
Mono:R71.69
5
R71.69
1001..1107
2107
CCGAGGTGGATTGAATGAGATGGCGAAAACCATCAGAATGGTTGAATTCAACAACAGAG
ACTTCAATCTGAGTAGAAGCCTCCCCTTCTTGAACATCATTGTCCCCAATGATTAAATCA
GGGACATGTCGAGTTGGTAGCTCTCGATCATGGCAGATGGTGATGGCGTGAGCAGTTGCA
TACTCCTTTGGATTCTGTATTGACTTCCCAGGAAGTCCTGTAACTTTAGGTGCAGAGGTA
GATGCTGATTGGCCTTCTAAGTATCTGACTTTGGTATTCAATGCCTCCATTTTGGCATTC
AGGTCAGCTTATGGTGCAATTCAGATAATTTCTTAGCAATTTCCATCGAGTTAGATGCTT
GTCCCTGTAGCAGATGTTGTACCATGTGTTTCATTTCAGCATCAGGAGCAGCAGGACCTT
GGTTTTGCTGAGGTGCAAACCCAGGTGGTGGTGGTTGCTGGTAGTTCCCCTGAAATTGTT
GCTTGGGAACGAAACCTTGGTTGTAGGGAACAAAAGGTTTGTTCTGACCTTGTTGTTGCT
GTGGAGGATATACTTGGTCTTGTGGATTAGCAACGTTGGTGCTGCGGTAGGAGAGGTTGG
GGTTGTTGGTTTTGAAGTTGTTATACCCTTTGTAGCCACTCTGGTTGTTGTTGATGTAGC
TGACCTCTTCTAACTGGTTATCCTCCCCATCTTAGACTTGATATTGCTCGTCATCAACAA
GGAAGTGCACATGCTTCTGCTGGCTAAGAAGAATCATGTCTAGCTTGTCATTCAGCGCTT
TGATCTCCTTCCTGTGTTTGTCATCAGAGTCAGTTGTGCTTCTGACGGTCCTATCGCAGT
CGTCGTTGTAATTACCATCTGATTGAGCAAGGTTCTCAACCAATTCCCAGCCTTCTTCAA
CATCTTTGTTCTGGAAATTCCCATTGCTGGCGGTATCCAGAAGCATTCTGATGCGTTGTA
AAACTCCTCTATAATGAGTGCTGAGCAGAGAGGCATTAGTGAAGCCATGATGAGGGCATT
GGTTGGTATAACCCTTAAAACACTCTCATGCTTCACAGAAGCTTTCACCAGCTTTCTGTA
AAAAGCCGGAGATCTCATTTCTGAGTCTTGCAGTTCTGGCGTTGGAGAAGAACTTTGATA
GAAAAGCCTTCTTGCAATCATCCCAGGTGGTGATTGAGTCATGGAGCAGATTCTTCTCCC
AGATGTGTGCTTTGTCGCCCAAGGAGAATGGAAACAAACGGAGCTTGAATCCGTTTTCAC
TGACACCATTGATTTTTGTTAGGTTGTAGAGCCTATCGAATTCATCAAGGTGGTCGAGTG
GATCCTCCATTGGCAAACCAGAGAATTTGTTTCCCTGAATCATCGAGATGAGACCACTCT
TAATCTTGAAGTTGTTGTTCTGGATAGCAGGAGGTGCAATTCCTTTCTTCTAACGATGGT
CCCTTGGTGCATCTCCAGCACCAATGTTGACATGGCCATTTTGTTGATTCTTTTCGTCAG
TCATCGAGTGGTTGTTGGGGCAAAAGGTTGACTATGTTTCTCCTTTCTCTGAGTTCGCGA
GCTATGCGGTCGATGTTATCGTTGAAAAGGAGGTTCTGATTGCCTGTTGATCGAGTTTGC
ATACAGCAGAGGTGTACCTAGATCAAAAAGACAACAAGAAAAACACACAGTTAGCAACCG
ATTTGAAAATTGAAAAAGAACTTGATCTAAGCAAGTTTGAAATCTCAAATGTAACACACA
AACACCCAATTGGCAACGGCGCCAAATTGATAATAGGTTTTTAGTCAATTATCCTAAACC
ACCAATCATGTCGTTGTAGTATTTTAGGTGTCAATCCAAATGGGTGTGATGCTAACAATC
AAGTTGTGATCAGAAGTCACTAAATCAAGCCAAGCAATAACAGATTTTGGTGTGTTCTAG
CAGTCCTAAGTGAGCATGCAGAAAACAGAAAATCAAGTAGAAACAAGAAAACACTCGACC
AACACAGCTCGATGCAGCTCAACACAGGGTGTGGTCGAGTGACAGGTCGAGTAACAGACA
TAAAATGTAACAGGGATACTCGACTCCAGAGTCTGTTGCCAGACAACTGGGTGGTCGAGT
ATCAGGTC
  Untranslated Region
  Coding Sequence
  snoRNA
CP002688
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved