Arabidopsis_thaliana Locus Mono:R43d
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:R43d
Arabidopsis_thaliana
Mono:R43d
5
R72e
1001..1087
2068
GTTTGAAAGTAGGTTTGAATCTATTGAGAATGAGTTCAAACAGATGAAAGAGCATCTGA
AGACCATTGGAGTAGGCCTTACTGACTAAAATGCCCAAGCTAACTCAGAATTATTCTCTA
AAGTGAAAATTAGAGATATGTTTTTAACAGTTGATCAACAAGAAATGCCAAAACCCAAAA
ATCAACTAACACCAAAAGGTCCAAAGAAACCTCCAAATAACTACTATGTTACTAGTCCTC
CTCAAGTAAGCTAACCGTTGAGTTATCAATACGCTATTTACTTACGATTAAGTTATTATC
ATGTGATGGTTGAGTTATCATTATGCTATTAAGTTACGACTGAGTTATAATTAAGTTATT
CGACTGAGTTGTCTACCTTATTTATTTTGGTTGAGTTATAACTTTAGTAGTTAGTTACGG
CTAAGTTAACGTTAGGTTATACGGCTGAGTTGTCTTTATTTTACTTACTTTTGGCTGAGT
TAACATTATCTTATTTAGTGACGACTAAGTTATCGTTATACATGTGACTGAGTTATCGTT
AGTTTACGCCTGAGTTATCTTTACGTTTTTGCAGTCGAAGGAAGTTGTAGATTTGGTGGT
AGAGAAGGATGGTGGTATTCCTGGGGTCAGTAGGAATCTTGAAGGCGAATTCCTGAAGAA
CGTTGATGTAAACCAATGTGACATTGATTTCATTGAGAGGTCTCCTGGTGCCCGGAATTT
ACGCGCCTCATCTAAGGCTAGGAGAAATTCCAGAGCGAAGCAAGATCCAAAGAAGAAAGC
TGTCGTTAAAGAGAAAACCCTAAATGAGCTAACCGTCAAAGAACCAGGCCCCCAAAAGAA
AAGAGGAAAAAAGCTGACGCTTCCAAAGGTGCCTACAAAGGTGAAACTAAAAATGCCAAA
ATCACATGCTATTGATGCGAAGATAGGAGATGCTGCTTCTGTCCCCAATATAGTTGAGGA
AGTCAAGGAAAAAGCTGACAAGATTGACGGTGAGAAGGACAATGATGATTCTATGTTTGA
TATTACAGACCAGTTACTAGCTGAAGACAATCGCATACTGCCTGAGTCTGATGAAAATGA
GGAGGAAAAGGTGAGGCTTGAGAGAGTAAAAGGAATAAGGAGAGAAATTGTTAAGCTGGC
CCCAGATGGGAGTTCAAAGCATTCACTCGTTAATGCGGCAGCAAAGGTTTTTCCATATAT
TGGAAACAACGGACTGAGTTGTATGAGGAAGGGCTGTGTGCCTTCACGATGAATCTATGA
TCCTATGGCACTGGTTGATCCGTTGTTTAAAAACCAATCCAAATCCGAATAAATCTGATC
TGATCCGAAAATCAGTCGAATACTATTCGGATTATAGACTCCCCAATCCGAAAAACGAAA
TCCGAATAAATCGATCCGAAATCCGAACGCCCAGACCTAAAAGAACTCATGAAATCTACA
TGCAAATACTTATCGACACTTATAAATCGTTAAAAATTTTGAAAACAATTAGATTTACTT
TCAAATAACTTACCAATATACTTGCAAATTGAAATTGAAACTTGCAAATTAGAAGAAATA
AAGAGAACAAATAGATTAACATGCTGAAAGTTCAATCAAGCGATGGAATACTGATATGAG
TTAAATTACCCTAATGAATACTCTCTCGAATAAAGAGGTTGTTATAGCATTTAGAGATCG
AATTCCACAAAGTTCTCGGATCACACAATAGACTAACAGTTTCAAATAAAGCTAAACAAA
AAATATTATAAAAGTAAAAGACAAGAAAGCAATTAAAAGTTGGTTTTAGATTCAGATGAT
TAAGATGTCAGGTTTAGGAAAACTCTCAGGAGATATCAGAATAGTAGATTTAGCAGTAAA
TTAGGAATATTATCGAACCATTCTAGAACATAAATCACTAATATAAAGTAACCGGTGGTG
TGTCGTGCTACTCACTATGCTTAATAGTATTGATTCCAACTCTCTTGTAAATCCCAAGAA
CTAAGCAAGCATTATAATCAGGTTTGATAAGTTCACCTAAGTAATGGACGCTAGCACGCA
TCTAAATACTAGGCTCATCTAAGATAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved