Arabidopsis_thaliana Locus AT3G61780
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT3G61780
Arabidopsis_thaliana
AT3G61780
3
R79b-2
2201..2265
5649
TCTAATCTATGGTTGTGAATTGTGAATCTTCCATCTCGCTATACATGTTGACTTGATAT
ACTTTAATGCTTATCAAGGTTTCCTCTGTTTTGGTTTTGTTTCTGGTTCAAAAATGAAAA
TCAGGTCTTTCACTGCTTCGGTCAATACTTCTGTCTTCACTTTGAGGCATTCCAGCTCGG
AATGGCTCCAGTCTACATGGCGTTCCTGCGTTTCATGGGGGACGAGACAGAAGCTCGAAA
CTACAATTACAGTTTAGAAGTGGGAGGTTATGGTCGGAAGCTGATATGGGAAGGAACACC
AAGAAGCGTAAGAGACAGCCACAGGAAAGTTAGAGACAGTCATGATGGACTAATTATACA
AAGAAACATGGCTCTCTTCTTCTCAGGTGGAGATAGGAAAGAGCTGAAACTTCGAGTCAC
TGGAAGGATATGGAAAGAGCAACAACAAAGTGGTGAAGGTGGAGGAGCTTGTATCCCAAA
CTTGTCTTGAAAATTAAAAAAAAAAAATCAAACTGATTTTGAAAACCTCACCGATTTGGC
CTTGTCTCTGTAACCATGGTTATCTGTAATTAGGGTTTTCTCTGACGATAAACTTGGGGT
TGTTCTTATGTATCTCTCTCTGTCTTTCTCATGTCATGGAGGTTTTTTTATTATAAAATA
TATAGTTCATTACAATTCTGCTATATCTGGAGGAAAAACGTAAAATGTTGAACCTTTTAC
TTTTATCAACTGTAGTGTTCATAAATTTATGTAATGCTTGTGTTGTGTCCACGAAACGAC
GACGTTTCATCATTGTTCTGTTAAACCCAGCTTTTGGAACTTGGAAGTGATGAGCTTTAT
ATCTGGAAAATGTAAAATGTTGAACCTTTTTTCAACTGTAGTGTTGTTCAAAGGCGTTAG
CTTTGTTTAAGAAACGACGACGTTTCATCATTGTTCTGTTAAACCCAGCTTTTGGGGGTT
TTCTCACTCGGAAGTGAGCTTTATCCCTTTGGTTTCCATCAATGGAGGTTCTACTAAACT
CCAATGATGGTTTCTTCAATTTCTCGTCTTTCTCGTCCAATTCGAACAGGAGACTCGCTA
ACCAACGTCGATTCAACTTGCCCATCTCCAAATTCCACTACTATCGCGTTTCAATTCTCC
GAGTCTCGGCTCGGTTCGGAGAGACCTCGAGGCGACGTAATTCGCTGAGGAAGAAGATCA
TCGGTGATGAGTATTGGCGTTCGACTCCGAAATCTTCTGAACCAGGTACGAAACCTCTAA
ACGAAAGCCATAAGTTTGGTCACTGTGATGATTTAAGTAGCACCGAGGGATTGAAAGATA
GGGTTGCTCAAGATTCAAATTTGCTGAATGAGCTTGAAGATTGGGTTGCTCGGTATAACA
AGGAAGCAGAGTTTTGGGGTATTGGTTCGAATCCCATTTTCACTGTCTATCAGGATTCTG
TTGGAAACGTAGAGAAAGTAGAGGTTGATGAAGACGAGGTCTTGAGTAGAAGAAGATCAG
CTCTTGGGGATTTGGAATCAGTGAGTTCTAAGCTTGTATATGCGAAGAAATTAGCTGAAC
AAATGGAGAATGGGGAACATGTGATCCATAAGGAGAGTTCTCTTGTCAAGTTCGTTTCTT
CTTCTTCTTCTTCAGAGGAAGAGTTTCGTCTCGTTAGCTCAGTCCAAAACGCAATTCTTC
GTCTTGACTTAATTCCAAAGTTGCCGGCGATTGGAAGAGCTGTTTTGTGTGGTTACATTG
GACTCTGGTTGCTGAAGACGGTGCTTGTGTATAGGAAGAGTAATGAGGTTGAGTGTACAG
AGTTGGAGAAGGAGATGATGAGGAGAAAGATGAAAGCTTGGCAGGAAAGGGATATGTCGG
AGAAAGGTACCGTGGAAGTTTTGCACAAGGAGGGTTTGGAAAAGCCATTGATGTCATTTG
AGAAGCCTAAGTTTGATCGAAATGAACTTATGACTAGTATTTCTAAAGTTAAGGGTTCAG
AGAAGAAACTGGAACTCGTGAATTCTCCTCATGTTGAGCTGGACTTTGTTGATAAGATCC
ATGAAATCAAAGCAATGGCTAGACGAGCACGGGAGATAGAAGCTGGCATAGAACTTAATG
AAAAGCAGAAGCTCGATGTGAACAAAGAAACAGGCGACAATGAGGAAGATATAAGCATTC
AGTCACAGAAGAGTCTTCCACATGAGGCTTTGACACACAGTGAAGGTGATGATGATAAAG
ATGAACGCTTGGGAACTTCGACTGACAGTGAGAACACTGAACTTTCTGGTTTTGCTGTTC
CGATGTTGAATGGGGCTATGGTAGATTTTGGTTTTCTGAATCATGAAATGGCAGCATCTG
ACAAAGAAAAGGTGAGTAATGTGGTACCACCAGTTCCTACAGACGGAGTCATCCAATCTT
CTGATGTCTCTAAGGATCAGTTAAGTATGATGAAGAATAGCACTGGTCGTAAGTCACGGG
TCATACGGTCTGTAAAAGAGGCTAAAGAGTTCCTTTCAAGAAGAAGTGGTGAGAAAGAGC
TTACTCAGGAACCTTCTCAGATGATAGCCCAAGATAGTGTTGAAATCTTCTCAAAGCAGA
GCGACGAAGAGCGTGGTGTAGCTAGAAAACACGAATTGGTTGACAAAAATAAAATCCTTG
GTGCAGCTGTCAATGGAACCTTGAAATCTGCACTTGAGTCTACTTCTTCTGAACCGTTGG
GGAAGGATGCTGATTGTCAACCCCAAAAGAATGATTACCAAAAACTCTCAGAACCTGGGA
ATGCAGTTAAGGGATCGAGCAAGCAAATAAATTCTTCAAATAAAATCGAAGAGCACAATT
TTAAATTTGCCAAAAGTTCTTCTGGTGGTACTGAACATATAGAGAAGGAAGAACCATCAG
GGAAGGGGAATTGGATAGAGAATAACTACCATGAATTTGAGCCTGTTGTTGAAAAAATGA
GAGCAGGATTTAGGGATAATTATATGGCTGCTAGAGAGGGTGAAACTCGGGAGCCAGGTA
CAATTGCTGAAATTGCAGAACTTTACCGCAGTGAGTATAATGATGAGCTTGAGTGGATGA
AGGACGAGAAGCTAAGGGACATTGTCTTCCATGTTCGAGATAATGAGCTGGCTGGTAGGG
ATCCATTTCACCTGATTGATGATGAAGATAAAGCTATGTTTTTGCAAGGCTTGGAGAAGA
AAGTTGAGAAAGAAAATGAGAAACTGTCTCATCTGCATCAGTGGATTCATTCAAACATTG
AAAACCTTGACTACGGAGTAGGTAATCTTCTACAACTTTGATTGAGACTCAGTTTGCTCA
ATATCTTACGTACACAAATTATGCATTAATCAGCTTGTCAAAATATATCTCAACCATCTC
CCTTCCTCTTATTATTCAGATGGCGTCAGTGTGTATGATCCACTAGAAAAGATCATACCG
AGATGGAAAGGGCCTTCACTTGATAAGAACCCCGAGTTTCTCAATAACTATCATGAACAG
CGTGAAGCACTGTTTTCTGAAAAAGCTGCATCTGTATCTCCTGTGAAATATGAAGAACAG
AGCTCTCATCAGGAATTATCAGAGTCTGCTTCCTCTGAGAACACTCTCACCCCTTCATCT
GAAATTACCTCAAGCCAGCCAAAGATTGTTGTAGAAGGAAGTGATGGATCTGTTAGACCT
GGTAAAAAATCAGGAAAGGAGTATTGGCAGCACACGAAGAAGTGGTCACGTGGGTTCCTT
GAGTTGTACAATGCAGAGACTGATCCAGAAGTGAAAGCTGTTATGAGAGACATGGGAAAA
GACTTAGACCGATGGATTACTGAAGACGAAATCAAAGACGCTGCTGATATAATGGAAAAG
CTGCCAGAGAGGAACAAGAAGTTCATGGAAAAGAAACTCAACAAACTCAAGAGAGAGATG
GAGTTGTTTGGTCCTCAAGCTGTTTTGAGCAAATACCGCGAGTATGGAGAAGATAAGGAA
GAAGATTATCTATGGTGGTTGGACCTTCCGCATGTACTGGTATGTTTTCCTGCTAAACAG
TTGACTGACATTGGAGAAACACAAAAGTCCTTGAAAATCTGATATGTCTTTTCATGTTTT
AGTGCCTTGAGTTGTACACAGTTGATGAAAACGGAGAGCAGCAAGTAGGGTTCTACACAT
TGGAGATGGCAACAGATCTCGAGTTAGAACCCAAACCACATCATGTGATTGCTTTCGAGG
ACGCTGCAGACTGTCGAAACCTCTGTTACATTATTCAAGCTCATTTGGATATGCTACGAA
GTGGAAACGTTTTCATTGTTCCGCGCCCGCCAAAGGTAATGAATTTAGCCAATGAAGAAA
CTTTAACTAGACGTGTTTCTGTTATCAATTCAAAGTTGTTCTCTTTAACCTACACAGGAT
GCATATCGAGAAGCCAAGGCGAATGGATTTGGTGTAACGGTTATTAGGAAAGGAGAACTG
AAGTTGAATATTGACGAGCCATTAGAAGAAGTAGAGGAAGAGATCTGTGAGATAGGAAGC
AAGATGTACCATGATAAGATCATGGGAGAACGATCTGTGGATATAAGCTCGTTGATGAAA
GGTGTCTTTAACCTGAAGACCAAACCTACTGGCCGAAGAAGAAAACGATCAAAGCAGGCT
CTTAAAGATTCTAACAAGAAAAGTAGCTGAGGCACCAATCCAAAGGGCCTATAGCAAACA
GAGATTGGAGGCAAACTTAGAAATGATAGCTGAGGGTACTTTCGTAGTTCGTTATGTTGA
TTCGTCCAGCGAATTTGGGCTACTTCTTTCTTCGTTACATATGTTAATTCGTTCAACGAA
TTTGGGCCCTTTTATGCACAAGAAATCCAAAGGACTGAAAAGGCTCAAATCCATATTTTT
TGGGCTTACAAAATGCCCATTCCCACAATCTCCCCCAAATAAATAGCTTCTATTTTCGTG
TATGATAGACACATGTTGTGTGTTTTAAACCTTGCCTTTTTGATTGATCATAGGTTGGTT
AGAGAGAGAGTATGTGATCCTACTTTAGTTCTTGGATCACCAAAGCGTATTAGTCAGTTC
TTCTTAAACCCTCTAAGAGACCCACAAAAATTTGTTGTTGTCGATTATCTGTTCTAAGAT
AGTCTGTCTCTAACATGCTTAATCTGTTGTGCAGTTTGAGAGTTACAGTAAGTTACTGAT
GCATTAAGTCACTAAACATGTCATCATCATAAAGATTTGCATTGGTTTAAACAAAAACAA
GCTCTCATTGCATATTCAGGGAATACAAAAAACGCAAAAAAGAACCCTCAAGGAAGAAGA
AATAAAGAGTTTACTTAATTTAAAGAGTTTTCTACAAACAAGAGATTTAGAGAGGTTCAA
GGTATTCACACATATGGCTACACAAAATCAGTAATCCTTTTGCCTCACTAAGCTGTCCTC
TTCCGGTTTGGTCAATAGGCTTGTCTCCAGCTGATAGGCTTGTCCAAAGCCATAGTGAGC
TTGGAATGGTTAGTAACAACCCTGATGGGTTTTGATGCTGTGCTAAGATAACATTGTACT
TTGCCGCTTTCATATCGTGATGATGCAATCTTCTTGTGAGATGTCTCCCATGATTAGCAT
CACATTTGATGGTGCAGGATTGTCAACCGCCCCAAAATAAAGATCTACGAAAATCTTCTT
ATCTCTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..3260, 3379..3998, 4082..4294, 4377..4649
1001..3260, 3379..3998, 4082..4294, 4377..4649
CP002686
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved