Arabidopsis_thaliana Locus AT5G28400
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT5G28400
Arabidopsis_thaliana
AT5G28400
5
R79c
2449..2511
6211
TTCAACCGAATTAACCATAAAACAATTTGTTTTTTTGTGTGGTTGTAAGTTTGTAAATA
CTACTAAGATATTTATAAATGTTAAACAAAAAGAAAGAGATAATAGGAGAAAAAGGAATC
TCATCATTGCACTGTTGGGATTAATATCCTCTCTGAGCCTTTTTTTTTTTTTTTTTTTTT
TGGGTTTGACCATTTTTATTGGCAGAATATTTTATCTGAGAGTCTCCGAGCATTAGAAAA
GGTGGTGACATTGGATAACAATCATTCCTAAAGCGTTAGTTGATTCACTATATAATCTGC
AACCAAGTATTTTAAAAGTGTATACTTTCACCACCACCTCTTCATTTTTTACCCCCCACA
AGTCCCTATAGTTAGTACTTCACATAAAGTTTTACATGTAACTTAATTATATAAATGGAA
TAGTATTATACGACTTAGACAGATACTAGGAAACAATTTTTTTTTTTTTTTTTTTTAAAT
GTTTGGGGAAAACTGAAACAAGAAATCTAAAAAAACACATAAAAGAAAGAAATAAAAAAT
AGTTACTTTTTAAAAATAAAGAGTCTTACTGAAGTTGTAGTTCAGATGAAATGAAATTAT
TATTTCAAATTGACAAAACAAAAAAAACAAATGGGATGTGCCATGTGTGAACTTTTAAAA
CAAAAGAGAATACTTTTAGGAAAAAAAATAAAGTGGCAAAAAGACTTTGAAGTATATATG
AGTAATATGGTAAAAATGGTATTCATGATTTTCTTTGAAGTCAAAAATACATGTTGCTTT
TGAGGTCTTGGTTATCAACGCCTGTCTGTCCCCTATTCTGTTGCATCTGTCTCTCGAACC
TCTGTTCCTTCCTTGTCTCTCGATAGACTCGTTTTATTCTGTTTTTTTCTCCATTAATTT
TCTCTTCCATTTGATCGGATCCGTACAGTCTCAGGCTCGCTCTGTCTCCCTCCGATCTGA
CCGATTCTTTTTCTTCGATCTGACCAATCAGAGTCACCAAAATGGCGGAGACGAAGGCCA
AGAGACTACTTAAAGTGGAAATCAGATTCAGCTTTCTCGTCCCAATTCGATTCACTAACA
AGAGGTACCAACATCGATTCAACTTGCCCATCTCCAAAAAGATCTTCGGTGACTCCAAAA
TGTTTTGTGCAAGGTACGAAACCTCTAAACGAAAGCCATAATTTCGATCACAGTGATGAT
TCCGAGGGATTGAAAGATAGGGTTGCTGACGATTCGAATTTGCTGAATGAGCTCGAAGAT
TGGGTTGCTCGGTATAACAAGGAAGCAGAGTTTTAAGGTATTGGTTCGAATCCCATTTTC
ACTGGATTCTGTTGGACACGTGGAGAAAGTAGAGGTTAATGAAGACGAGATCTTGAGTAG
AAGAAGAAGATCAGGTCTTGGGGATTTGGAATTAGTAAGTTCTAGGCAGCACAAGGATTT
GTAAGATCAGTTACAGTGGAAGTTTTGCACATCGCGACACAGTGAAGTATTTGATAAAAA
TGAACGCTTGGGAACTTGTCATCAGTGTTTTCTCAGCTTGTCAAAATATATCTCAACTAT
CATGAACAGCGTGAAGCATTGTTTTCTGGAAAAGCTGCATCTGTACCTCCTGTGAAATAT
GAAGAACAGGGTATTGTGGTATTTGCTCGAATCCCATTTTCACTGTCTATCTGGATTCTG
TTGGAAACGTGGCGAAAGTAGAGGTTGATGAAGACGAGGTCTTGAGTAGAAGAAGATCAG
GTCTTGATGATTTGGAATCAGTGAGTTCTAAGCTTGTATATGCGAAGAAATTAGCTGAAC
AAATGGAGAATGGGGAATATGTGACCCATAAGGATACTTCTCTTCTCAAGTTCGTTTCTT
CTTCTTCTTCTTCTTCTTCAGAGGAAGAGTTTCGTTTCGTTAGCTCAATCCAAAACGCAA
TTCTTCGTCTTGACTTAATTCCAAAGTTGCCGGCGATTGGAAGAGCTCTTTTGTTTGGTT
ACATTGGACTCTGGTTGCTGAAGACGGTGCTTGTGTATAGGAAGAGTAATGAGGTTGAGT
GTACAGAGTTGGAGAAGGAGATGATGAGGAGAAAGATGAAAGCTTGGGAGGAAAGGGATA
TGTCGGAGAAAGGTACCGTGGAAGTTTTGCACAAGGAGGGCTTGGAAAAGCCATTGATGT
CATTTGAGAAGCCTAAGTTTGATCGGAATGAACTTATGAGTAGCATATCTAAAGTTAAGG
GTTCAGAGAAGAAACTGGAACTCGTGAATTCTTCTCATGTTGAGCTGGACTTTGATGATA
AGATCCATGAAATCAAAGTAATGGCTAGGCGAGCACGGGAGATAGAAGCTGGCATAGAAC
TTAATGAAAAGGAGAAGCGCGATGTGAACAAAGAAACAGGCGACAGTGATGAAGATATAA
GCATTCAGTCACAGAAGAGTCTTCCACATGACGGTTTGACACACAGTGTAGGTGATGATG
ATAAAGATGAACGCTTGGGAACTTCGACTGACAGTGAGAACACTGAACTTTCTGCTTTTG
CTGTTCCGATGTTGAATGGGGCTATGGTAGATTCTGGTTTTCCGAATCATGAAATGGCAG
CATCTGACAAAAAAAAGGTGAGTAATGTGGTACCACTAGTTCCTACAGACGGAGTCATCC
AAGCTTCTGATGTCACTAAGGATCAGTTAAGTATGATGAAGAATAGCACTGGTCGAAAGT
CACGGGTCATACGGTCTGTAAAAGAGGCTAAAGAGTTCCTTTCAAGAAGAAGTGGTGAGA
AAGAGCTTACTCAGGAACTTTCTCAGATGGCCCAAGACAGTGATGAAATCTTCCCAAAAC
AGAGCGACGAAGAGCGTGGTGTAGCTAGAAAACACAAATTGGTTGACAAAAATAAAATCC
TTGGTGCAGCTGTCAATTGAACCTTGAAATCTGCACTTGAGTCTACTTCTTCTGAACCGT
TGGGGAAGGATGTTGATTCTCAACCCCAAAAGAATGACTACCAAAAACTCTCAGAAACTG
GGAATGCAGTTAAGGGATCGAGTTCAAATAAAAGAGAAGAGCTCAAATCAGCCAAAAGCT
CTTCTGGTGGTACTGAACATATAGAGAAGGAAGAACCATCAGGAAAGGAGAATTGGATAG
AGAAAACTACCATGAATTTGAGCCTGTTGTTGAAAAACTGAGAGCAGGATTTAGGGATAA
TTATATGGCTGCAAGAGAGAGAGAGAAACTCAGGAGCCTGGTACGATTGCTGATATTGCA
GAACTTTACCGCAGTGAATATAATGATGAGCTTGAGTGGATGAAGGACGAAAAGCTAAGA
GACATTGTCTTCTGTGTTCGAGATAATGAGCTGGCTGGTAGGGATCCATCTCACCTGATT
GATGCTGAAGATAAAGCTATATTTTTGCAAAGCTTGGAGAAGAAAGTTGAGAAAGAAAAT
GAGAAACTGTCTCATCTGCATCAGTGAATTCATTCAAACGTTGAAAACCTGGACTACAGA
GTAGGTAATCTTCTCTACAACTTTGATTGAGACTAAGTTTGCTCAATATCTTACGTACAC
AAATGATGCATTAATCAGCTTGTCAAAATATATCTCAACTATCTCCCTTCCTCTTATTAT
TCAGATGGCGTCAGTGTGTATGATCCACTAGAAAAGATCATACCGAGATGGAAAGGGCCT
TCGCTTGATAAGAACCCCGAGTTTCTCAATAACTATCATGAACAGCGTGAAGCACTGTTT
TCTGGAAAAGCTGCATCTGTATCTCCTGTGAAATATGAAGAACAGAGCTCTCATCAGGAA
TTATCAGAGTCTGCTTCCTCTGAGAACACTCTCACCCCTTCATCAGAAATTACCTCAAGC
CAGCCAAAGATTGTTGTAGAAGGAAGTGATGGATCTGTTAGACCTGGTAAAAAATCAGGA
AAGGAGTACTGGCAGCACACGAAGAAGTGGTCACGTGGGTTCCTTGAGTTGTACAATGCA
GAGACTGATCCAGAAGTGAAAGCTGTTATGAGAGACATGGGAAAAGACTTAGACCGATGG
ATTACAGAAGACGAAATCAAAGACGCAGCTGATATAATGGAAAAGCTGCCAGAGAGGAAC
AAGAAGTTCATGGAAAAGAAACTCAACAAACTCAAGAGAGAGATGGAGTTGTTTGGTCCG
CAAGCTGTTGTCAGCTAATACCGCGAGTATGGAGAAGATAAGGAAGACGATTATCTATGG
TGGTTGGACATTTTATTACTAAAAAGCTCAGTTCGAGCAGGCACTTATGCAAGAGATGCT
GACTGTTTGTTTTTAACCGAAAAGAGCTTATTGGTAAGAGATGTTTCTTGTGGATAATAT
AACTCTTCTTTGTGGGTAAAAATTGGTTTGTTATGTAAACTAGTAACTTGAATATTGTTT
TATCTCAGATGTTATCAGTGCTGTTTAAAGTGTATGGGGCTATGGTAGATTCTGGTTTTC
CGGAGCATGAAATCGCAGCATCCGACAAAGAAAAGGTGAGTAATTTGGTACCACTAGTTC
CTACACACGGAATCATCCAATCTTCTGAAGCAGAGTATTGTGGTATTTGTTCAAATCCCA
TTTTCACTGTCTATCTGGATTCTGTTGGAAATGTGGCGAAAGTAGAGGTTGATGAAGACG
AGGTCTTGAGTAGAAGATCAGGTCTTGATGATTTGGAATTAGTGAGTTCTAGGCTGCAGA
AGGTTTTGGAAGATCAGGTACGATGGAAGTTTTGCAGAAGGAGGGTTTGGAAAATCCATT
GGTTTCGTATGACCGGAAAGATTGATCTGTTACTGACTTACTGCTGATGATGTTTCCGGA
TCAGCTACTACTTCATATCTGTTACTGCTGATGTTTCGGAAGATTGATCTGGAGGTTATA
TCCCACAGGCTTATTAAGGGACCAAGGCATCATATTTCTATACGATCTTTTTCTGAAACT
TATGGTCATTTACAGGACCATGCATGGGTCAGACAAGGATTGATGTATCCATTTACGGAA
TTTATGGGCAAGTAAGTACATGAGACGCTCATATTTACTGGATTCTTTCATATTTGTCTG
TTTGTGTCTGTTCCTTAGCCTTTCATAACTTCAGATTTCAGGATTAGACAAACTTGTACA
ATTACAAGCCAAATTTAAGAATGCACTTGAGGAAGCAGTTTTAGCAGAAAATGGGGTCGA
GAATAATTGTAGAGATGCTGAAATCAGCTGCCCAGATTCCTCTGCGCCTTAATCCGACCA
GGACTATGGACCTGCTTCTAGATTTCAGGCACGTTTTCTTGACAGTTGACACATATTCCT
TTTCGTTTTTTTTTTGGTTAGATGTTCAAGTTTGCTCTTCTAATTGGTTTGGGAAGACAA
AAAGTAAATAAATTGACAGTTCTATAAGCATCCTGTATAATTCATAATCAGTTCTGTAAG
CATCCTGTAGCATCTACGTCTGGTGATATATTTTCTGTTCTAAGTCATGAAGGCATTTAT
ACATACTACATAGGCGTGGACGTACAGTCTGTATCTGACTCTTTTACAGTTATTGGGAAT
ACACACCCTAAACGATTTGCTTATTTAATTACTGTGTAGGGTTCATGTCATGAGGACATA
AGGACATGCGACGCTTGTGGCTCAGGTTGTGTGATGTCAACAGGTTAGATAATGAGGGAA
AAGGAACCTGGTGATGGAAAGGGTTATCCATTTGTAACATTCAGATGTAAGGACTTAGCT
GCTGAAGCAATTGATAATCTAAATAACACTGTATTCAGAGTAAGTTCTTTGACCTGATTC
TTAATAGTTACCTAGAATTTTGATGGATTGGTGTTTCCGAATATTTCTGGCTCTTATTTG
TTTGTTTACTTATTGTTATTCAATAGGGTAAAAGGATAAAATGTTCGACTACCTAAGCAA
AGCATCGTCTCTTTCTTGGTAATGTCCCTAGAAATTGGATGGAGTCAGACATTAAGAAAG
CAGCAAATAGAATTGGTCCAGTCGTTCAAATTGTCGAACTCCTAAAGGTTTGTCTCCTGC
AACTTGGATAAGTTTCAGCCTATAGTGTATATCTAGTTAGTTCTGTAACTTTCATCTCAA
CTTCACGTATAATTGTAACTTACAGAAGTGAATTTTCTGTAGAAATTAATACATTTCTTG
ATCAGTTTTTCTATTTGGTTTTGTTAAAATCACAGGAACCACAAAATATGGGCCGGAATC
GTGGATTTGCTTTCATCGAGTATTACAACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1083, 1193..1270, 1435..1538, 1629..2861, 2949..3144, 3197..3442, 3614..4148, 4388..4696, 5074..5211
1001..1083, 1193..1270, 1435..1538, 1629..2861, 2949..3144, 3197..3442, 3614..4148, 4388..4696, 5074..5211
CP002688
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved