Arabidopsis_thaliana Locus AT5G28320
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT5G28320
Arabidopsis_thaliana
AT5G28320
5
R79b
2443..2507
6207
TCTCTCTTTAGGTCTTATGGAACAACTCTCCATAGTCTCTCTATATAGAACTTAGCTAC
CCCTAAGTATATCTCTCATGAGGTCTCTCTTGACTCTCATGTTTATCTCATGAGGTCTCT
CTCGACTCTCATGAGATCTCTCTTGAGATCTCTCTTGATGACTCACATCTTGAGCTCTCT
CTTTGATCCTCTTGGATGCTTTTGCTCTCTTGTGTTATCTTCTTCTTCTTCATAGAGATC
ATATATATACTAGAACCAAACACCTCCTTTGCCTATTGTGAATAGGAATACTTACAAATC
TTATCCAACTGGACATTATTTGTATTTCTTTTTCTCTTGATTTCCTTTCTTGAATTTCCT
TTCTTGTATCTCTTCTAGCATCTTCTACAAGGAGATAACTTGCCCCTCAAGTAAGTTGGA
ATTATCCAACATTCTTCCCAACTGCAAATTAGAGGGAATCATTTACAATTAATGGAATAT
TTGTTGCTAATTTGATTTTTTCGCAAGTTATGTTGCAAACCTTGGAACCGAGGGGATAAT
CTCCTTTGAGTGGCCAAAACCGTTGCATAACTAACCGACTGGTAGCAGAGATGCGACGGA
AAACGTCGATAAGTAAACCGATGGCAGTATTTGCGACATCTTCAGAGAAGCTTGAGCCAA
CGTTGGCGACGGAGATACCTCAACGACGACACTCAACTAAGTCAACATGGTCAACGCCAG
CGATGATAGTAACAACCAAGCGAAGAGATTTTCTTTGAAGTCAAAAATACATGTTGCTTT
TGAGGTCTTGGTTATCAACGCCCGTCTGTCCCCTATTCTGTTGCATCTGTCTCTCGAACC
TCTGTTCCTTCCTTGTCTCTCGATAGACTCGTTTTATTCTGTTTTTTTCTCCATTAATTT
TCTCTTCCATTTGATCGGATCCGTACAGTCTCAGGCTCGCTCTGTCTCCCTCCGATCTGA
CCGATTCTTTTTCTTCGATCTGACCAATCAGAGTCACCAAAATGGCGGAGACGAAGGCCA
AGAGACTACTTAAAGTGGAAATCAGATTCAGCTTTCTCGTCCCAATTCGATTCACTAACA
AGAGGTACCAACATCGATTCAACTTGCCCATCTCCAAAAAGATCTTCGGTGACTCCGAAA
TGTTCTGTGCAAGGTACGAAACCTCTAAACGAAAGCCATAATTTCGATCACAGTGATGAT
TCCGAGGGATTGAAAGATAGGGTTGCTCACGATTCGAATTTGCTGAATGAGCTCGAAGAT
TGGGTTGCTCGGTATAACAAGGAAGCAGAGTTTTAAGGTATTGGTTCGAATCCCATTTTC
ACTGGATTCTGTTGGACACGTGGAGAAAGTAGAGGTTAATGAAGACGAGATCTTGAGTAG
AAGAAGAAGATCAGGTCTTGGGGATTTGGAATTAGTAAGTTCTAGGCAGCACAAGGATTT
GTAAGATCAGTTACAGTGGAAGTTTTGCACATCGCGACACAGTGAAGTATTTGATAAAAA
TGAACGCTTGGGAACTTGTCATCAGTGTTTTCTCAGCTTGTCAAAATATATCTCAACTAT
CATGAACAGCGTGAAGCATTGTTTTCTGGAAAAGCTGCATCTGTACCTCCTGTGAAATAT
GAAGAACAGGGTATTGTGGTATTTGCTCGAATCCCATTTTCACTGTCTATCTGGATTCTG
TTGGAAACGTGGCGAAAGTAGAGGTTGATGAAGACGAGGTCTTGAGTAGAAGAAGATCAG
GTCTTGATGATTTGGAATCAGTGAGTTCTAAGCTTGTATATGCGAAGAAATTAGCTGAAC
AAATGGAGAATGGGGAATATGTGACCCATAAGGATACTTCTCTTCTCAAGTTCGTTTCTT
CTTCTTCTTCTTCTTCAGAGGAAGAGTTTCGTTTCGTTAGCTCAATCCAAAACGCAATTC
TTCGTCTTGACTTAATTCCAAAGTTGCCGGCGATTGGAAGAGCTGTTTTGTTTGGTTACA
TTGGACTCTGGTTGCTGAAGAGGTGCTTGTGTATAGGAAGAGTAATGAGGTTGAGTGTAC
AGAGTTGGAGAAGGAGATGATGAGGAGAAAGATGAAAGCTTGGGAGGAAAGGGATATGTC
GGAGAAAGGTACCGTGGAAGTTTTGCACAAGGAGGGCTTGGAAAAGCCATTGATGTCATT
TGAGAAGCCTAAGTTTGATCGGAATGAACTTATGAGTAGCATATCTAAAGTTAAGGGTTC
AGAGAAGAAACTGGAACTCGTGAATTCTTCTCATGTTGAGCTGGACTTTGATGATAAGAT
CCATGAAATCAAAGTAATGGCTAGGCGAGCACGGGAGATAGAAGCTGGCATAGAACTTAA
TGAAAAGGAGAAGCGCGATGTGAACAAAGAAACAGGCGACAGTGATGAAGATATAAGCAT
TCAGTCACAGAAGAGTCTTCCACATGACGGTTTGACACACAGTGAAGGTGATGATGATAA
AGATGAACGCTTGGGAACTTCGACTGACAGTGAGAACACTGAACTTTCTGCTTTTGCTGT
TCCGATGTTGAATGGGGCTATGGTAGATTCAGGTTTTCCGAATCATGAAATGGCAGCATC
TGACAAAAAAAAGGTGAGTAATGTGGTACCACTAGTTCCTACAGACGGAGTCATCCAAGC
TTCTGATGTCACTAAGGATCAGTTAAGTATGATGAAGAATAGCACTGGTCGAAAGTCACG
GGTCATACGGTCTGTAAAAGAGGCTAAAGAGTTCCTTTCAAGAAGAAGTGGTGAGAAAGA
GCTTACTCAGGAACTTTCTCAGATGGCCCAAGACAGTGATGAAATCTTCCCAAAACAGAG
CGACGAAGAGCGTGGTGTAGCTAGAAAACACAAATTGGTTGACAAAAATAAAATCCTTGG
TGCAGCTGTCAATTGAACCTTGAAATCTGCACTTGAGTCTACTTCTTCTGAACCGTTGGG
GAAGGATGTTGATTCTCAACCCCAAAAGAATGACTACCAAAAACTCTCAGAAACTGGGAC
TGCAGTTAAGGGATCGAGTTCAAATAAAAGAGAAGAGCTCAAATCAGCCAAAAGCTCTTC
TGGTGGTACTGAACATATAGAGAAGGAAGAACCATCAGGAAAGGAGAATTGGATAGAGAA
AACTACCATGAATTTGAGCCTGTTGTTGAAAAACTGAGAGCAGGATTTAGGGATAATTAT
ATGGCTGCAAGAGAGAGAGAGAAACTCAGGAGCCTGGTACGATTGCTGATATTGCAGAAC
TTTACCGTAGTGAATATAATGATGAGCTTGAGTGGATGAAGGACGAAAAGCTAAGAGACA
TTGTCTTCTGTGTTCGAGATAATGAGCTGGCTGGTAGGGATCCATCTCACCTGATTGATG
CTGAAGATAAAGCTATATTTTTGCAAAGCTTGGAGAAGAAAGTTGAGAAAGAAAATGAGA
AACTGTCTCATCTGCATCAGTGAATTCATTCAAACGTTGAAAACCTGGACTACAGAGTAG
GTAATCTTCTCTACAACTTTGATTGAGACTAAGTTTGCTCAATATCTTACGTACACAAAT
GATGCATTAATCAGCTTGTCAAAATATATCTCAACTATCTCCCTTCCTCTTATTATTCAG
ATGGCGTCAGTGTGTATGATCCACTAGAAAAGATCATACCGAGATGGAAAGGGCCTTCGC
TTGATAAGAACCCCGAGTTTCTCAATAACTATCATGAACAGCGTGAAGCACTGTTTTCTG
GAAAAGCTGCATCTGTATCTCCTGTGAAATATGAAGAACAGAGCTCTCATCAGGAATTAT
CAGAGTCTGCTTCCTCTGAGAACACTCTCACCCCTTCATCAGAAATTACCTCAAGCCAGC
CAAAGATTGTTGTAGAAGGAAGTGATGGATCTGTTAGACCTGGTAAAAAATCAGGAAAGG
AGTACTGGCAGCACACGAAGAAGTGGTCACGTGGGTTCCTTGAGTTGTACAATGCAGAGA
CTGATCCAGAAGTGAAAGCTGTTATGAGAGACATGGGAAAAGACTTAGACCGATGGATTA
CAGAAGACGAAATCAAAGACGCAGCTGATATAATGGAAAAGCTGCCAGAGAGGAACAAGA
AGTTCATGGAAAAGAAACTCAACAAACTCAAGAGAGAGATGGAGTTGTTTGGTCCGCAAG
CTGTTGTCAGCTAATACCGCGAGTATGGAGAAGATAAGGAAGACGATTATCTATGGTGGT
TGGACATTTTATTACTAAAAAGCTCAGTTCGAGCAGGCACTTATGCAAGAGATGCTGACT
GTTTGTTTTTAACCGAAAAGAGCTTATTGGTAAGAGATGTTTCTTGTGGATAATATAACT
CTTCTTTGTGGGTAAAAATTGGTTTGTTATGTAAACTAGTAACTTGAATATTGTTTTATC
TCAGATGTTATCAGTGCTGTTTAAAGTGTATGGGGCTATGGTAGATTCTGGTTTTCCGGA
GCATGAAATCGCAGCATCCGACAAAGAAAAGGTGAGTAATTTGGTACCACTAGTTCCTAC
ACACGGAATCATCCAATCTTCTGAAGCAGAGTATTGTGGTATTTGTTCAAATCCCATTTT
CACTGTCTATCTGGATTCTGTTGGAAATGTGGCGAAAGTAGAGGTTGATGAAGACGAGGT
CTTGAGTAGAAGATCAGGTCTTGATGATTTGGAATTAGTGAGTTCTAGGCTGCAGAAGGT
TTTGGAAGATCAGGTACGATGGAAGTTTTGCAGAAGGAGGGTTTGGAAAATCCATTGGTT
TCGTATGACCGGAAAGATTGATCTGTTACTGACTTACTGCTGATGATGTTTCCGGATCAG
CTACTACTTCATATCTGTTACTGCTGATGTTTCGGAAGATTGATCTGGAGGTTATATCCC
ACAGGCTTATTAAGGGACCAAGGCATCATATTTCTATACGATCTTTTTCTGAAACTTATG
GTCATTTACAGGACCATGCATGGGTCAGACAAGGATTGATGTATCCATTTACGGAATTTA
TGGGCAAGTAAGTACATGAGACGCTCATATTTACTGTATTCTTTCATATTTGTCTGTTTG
TGTCTGTTCCTTAGCCTTTCATAACTTCAGATTTCAGGATCAGACAAACTTGTACAATTA
CAAGCCAAATTTAAGAATGCACTTGAGGAAGCAGTTTTAGCAGAAAATGGGGTCGAGAAT
AATTGTAGAGATGCTGAAATCAGCTGCCCAGATTCCTCTGCGCCTTAATCCGACCAGGAC
TATGGACCTGCTTCTAGATTTCAGGCACGTTTTCTTGACAGTTGACACATATTCCTTTTC
GTTTTTTTTTTGGTTAGATGTTCAAGTTTGCTCTTCTAATTGGTTTGGGAAGACAAAAAG
TAAATAAATTGACAGTTCTATAAGCATCCTGTATAATTCATAATCAGTTCGGTAAGCATC
CTGTAGCATCTACGTCTGGTGATATACTTTCTGTTCTAAGTCATGAAGGCATTTATACAT
ACTACATAGGCGTGGACGTACAGTTTGTATCTGACTCTTTTACAGTTATTGGGAATACAC
ACCCTAAACGATTTGCTTATTTAATTACTGTGTAGGGTTCATGTCATGAGGACATAAGGA
CATGCGACGCTTGTGGCTCAGGTTGTGTGATGTCAACAGGTTAGATAATGAGGGAAAAGG
AACCTGGTGATGGAAAGGGTTATCCATTTGTAACATTCAGATGTAAGGACTTAGCTGCTG
AAGCAATTGATAATCTAAATAACACTGTATTCAGAGTAAGTTCTTTGACCTGATTCTTAA
TAGTTACCTAGAATTTTGATGGATTGGTGTTTCCGAATATTTCTGGCTCTTATTTGTTTG
TTTACTTATTGTTATTCAATAGGGTAAAAGGATAAAATGTTCGACTACCTAAGCAAAGCA
TCGTCTCTTTCTTGGTAATGTCCCTAGAAATTGGATGGAGTCAGACATTAAGAAAGCAGC
AAATAGAATTGGTCCAGTCGTTCAAATTGTCGAACTCCTAAAGGTTTGTCTCCTGCAACT
TGGATAAGTTTCAGCCTATAGTGTATATCTAGTTAGTTCTGTAACTTTCATCTCAACTTC
ACGTATAATTGTAACTTACAAAAGTGAATTTTCTGTAGAAATTAATACATTTCTTGATCA
GTTTTTCTATTTGGTTTTGTTAAAATCACAGGAACCACAAAATATGGGCCGGAATCGTGG
ATTTACTTTCATCGAGTATTACAACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1083, 1193..1262, 1345..1417, 1525..1638, 1704..1963, 2020..2878, 2990..3140, 3199..3332, 3600..4130, 4227..4288, 4384..4692, 5070..5207
1001..1083, 1193..1262, 1345..1417, 1525..1638, 1704..1963, 2020..2878, 2990..3140, 3199..3332, 3600..4130, 4227..4288, 4384..4692, 5070..5207
CP002688
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved