Arabidopsis_thaliana Locus Mono:U40-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:U40-2
Arabidopsis_thaliana
Mono:U40-2
U40-2
1001..1083
2083
ACGGAACCAACCAAGCTGTAATGTTCACAGCGAAAAACGCGTTTGACATACTCTTGTGG
AACAAACACGAAGGTGACGGTAAAATCTTGCAGCCATGGCAGTCAATGATCTCAGGGTTT
TTAGCTGGAACCGCAGGTCCGTTCTGCACAGGACCGTTTGATGTGGTGAAAACGAGGTTG
ATGGCTCAGAGCAGAGACAGTGAAGGTGGGATTAGATATAAAGGGATGGTTCATGCCATT
AGAACGATTTATGCAGAGGAAGGATTAGTGGCCTTATGGAGAGGGTTATTGCCGAGGCTA
ATGAGGATTCCTCCAGGACAAGCCATTATGTGGGCTGTTGCTGATCAAGTCACTGGTCTT
TATGAGATGAGATATCTTCGGAATGCTCCTTTATAGGCAGAGACACTTTTTGAAATTCAG
TGTTTCTAGTTGGTGTATTTCTGAAAATTCTTGTTAGGATTTTGATTTGATCAAGAAAAA
TAAACCTAATCGCACATTTTATAACGATGTTACTCTATAATCAAATTTTGGGAGTTCCAT
TTTGTTGTTGTCTGTAAGACTCTGACTAAATAAGTTTTACTACAAAGCATAGCAAAATTA
CGCTTAAAAACGTAAAAAGTGAATACCACTGATTTATCATTTATATACTATAAGGCCCAA
AATTGGCAACAGTGTCAGGCAAATTCAGTTTGTCACTCTTAAAACTGTCACATCCATATT
AGTTTGGGCTGGGGTCATTTTGTTATGGGCCACATTTGGAACATATAGGCCCACAGTTTT
CAACCGCCTTCGCCAATTCCCTTATATATACTATTAACGCCAACGCAACTTTAGGGCTTT
CATCAAAACCCTAGTTAGCCGCCGCCATCTTTACCATCATCATCATCGCAACCTCTCCTT
TATATAGACGCTTCTTTTGGCTGTTGTCATCTATCTTCCTCTAGTTAATTCTTTGAAAAT
ATTTTTTTGTTTGCTCGGTTAAAAAGTTTTGTGCAATTTGTTCCTAATGAGGATATTTAT
CGAAAGCTATGGATCTGTTTATCAGTTCCATATGATGCTATATTGTCATAGTTACTCTGA
TGGGAAATTATTATTATTTTTTTTATAAAAAAAATCAAATTTTGATAGCTTCTTGTTTTA
AAAAAGAAGGCAACTTTTTGCCGAGTGAATCGAACATCGATCTCTCTCTTTTTCCCAGTT
GCCCAAATCATGTAATGGCTGCGTGAGGATTTTTTGATTGGTTATTCAATCTTTTATATA
ACCTATCTTTTCCTCTTTGCTGCTACATAATCTTATTGAAATTTATGATTAATGGTTGGA
ATTCGTAGGAGGCGTGACATTAAGTCCGTATCGATATTAGTAGCTTGGTGAAGATATAGA
TTAATACGATATTAATGATCCTTTTATGCCCTCACCATCTTAAACAATTTGAAGTTTCTT
ATTCTTCATCAGGGTGATGATATCAACGCAATTTTCGTCACTTAGAACTTATATGGCTAC
CCATTGAATTGCATAACCTGGTTTCGTAGAAGTTCGTCAATTCTGTCTGATTACTGAAGC
ACACAAACTAAAATCAATAACCCTGTTTTTATTATGTTGTAATTTGTAAATGTTCGTCAC
TGAATCTGTTTATTTCTAACTAGAAACCTTGACAGCTGATTCATTTTCGCTCAAGGATTT
GTTTCATTTTTGAAATTTGTTGGGCTTGTGGCACCTAACCTTCAGTTAGAGATGTCAAAC
GGGCTTAATGTCCTTGGGCTAGACCTGTCCTAATATAAATCGTCTGTTTCCAGTTAAGCC
TAAAACTGAACTAATTAATATGGGCTAAAATCATTTAGGCCCGTCTGTTAATAGTCCGAA
TTCATTTGGACATAGGCTGTCCAATAATCATGAAACGTTAGGGTTATGAATTTTTGTGGA
AAAATTGGATTTGAGAACAAAATTTCCTTCTGTCAGAGAATGGTCTTAGGATTTGGAAAC
TAGCCCTCGTTTAACGACAAAACGTTCTAGTAGTAGTCATATGACTTAAATTAAATGATA
TACTTTTTGGGAAAAGTAGTTGTATGAAACTGATCAATCAAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved