Arabidopsis_thaliana Locus FIB1 (FIBRILLARIN 1) (FIB1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana FIB1 (FIBRILLARIN 1) (FIB1)
Arabidopsis_thaliana
FIB1 (FIBRILLARIN 1) (FIB1)
5
U60.1F
2550..2623
4518
GGCAAGAACTGAGCAACTTGATATAAGCCTCTCTAGAGAATTTTCATCTTTGAACACCA
CATAAAAAAGGCGTAATATGTTGAGTGACGGGAGGCAAACCGAAGAAGGAACATCCACTA
TAATCTTGTCCGAAAGAGTCAATTCCACAAGTGTTTTGCATGTGTAAAGACTCTTAGGCA
AGCTGGTAGGCTCTGCCGTCCAGTGGAGCTCTAACTCTAGCTTGCGCACAAAGCGATCAA
CTGCATTTGCAACTAATTTCCCAACATCTACCTCAATAGAAAATTTTTACCGAGTTGGAT
GCACAAAGTTTCTAGAAAAGGTGCCTTGTGAAGTTCCAATAACTTTTCAAGAAACTTCCA
CACGCTTTCGCATTCATCACCAGGATCACTGTACTCGAGTTTAGGCAACAACGTCCAGAC
ATAACGCCATCGTTTTGACAATATCATTGTCCCAACTGCATCTTTGATCGGTACAAGCAA
CAAAATCTGGATAAGCAAATCGTCGGGCAACGAACTGATCTCGTCTCTAGAAGCAACAAC
CTCTTCATCAATTCTTTGACAACGTTCGGCCATTAGTGATGTAATAGCTAGCTGAGTTTG
TGATAAAGATTTCAAATATAGGTAAGCAGAGACGAGGAGGAGCAAGTCGAACCCTAAAAA
CTTTAGATGATCGAGAACCTTAGATATATTCGTAATTTCTCTATGAGAAATTGAGAATAA
GTGAATAACTAACTCTTCTTGTCTCACAAAAATAAAACCCTAACTTATCTTTTCCGTGAG
ACATAAACAAACCCACTTTGGGCCAATAAAATCGGCCCATTATTATCTTGACCCAATCCG
GATCAAACCCAACTCCATACTTTGGAGTTTGGACCCATCGTTACCAATGTAGTAGACTAA
TGTAGTTAAGATATATATAATAGAAGGGCCTATTTATAAAATACAAGAAATGTTACCAAA
GCATAAACCCTAAAAGCCCTAAAATCTTAATATATAAACCAACTCACAGAGACTCTAAAA
TCAGCCACCACCGCACATCTCTCTCCTTTGCCCTCGTTTTTTTTCGGTTCTCGTCTTTCG
TTCTTCACTTTTAGACAAGCAAATATGAGACCCCCAGTTACAGGTAAGAACCTTAGTTAA
AGTTTATGTCTTTCTTGTTCTGTCTGCCTCTAGAGTATAACCCTGTCCGTATCAAATCTG
AATTCGTATCATTACGGTTTCTGTAGTTTGAATTGGTAGTTAGGGTTTTAATTCATGAGC
CTTTTGTATCTTCACTGTTTCAATAAAGTTCAAAGATAAAAGTAGAGATTTTTAATAACA
CTCTGTTCTTCCGTTTAGTTAATTTTCTGTATGTTGGTATTGTTATAATCAGGAGGACGT
GGTGGTGGAGGATTCAGAGGTGGAAGAGATGGTGGTGGAAGAGGTTTTGGAGGTGGAAGA
AGCTTTGGAGGAGGCCGTAGTGGTGACAGAGGCCGTAGTGGGCCTCGCGGCAGAGGACGT
GGTGCGCCTCGTGGTCGTGGAGGACCACCTCGTGGAGGAATGAAAGGAGGAAGCAAAGTG
ATTGTTGAGCCTCACAGACATGCGGGAGTGTTTATTGCTAAGGGTAAAGAAGATGCTCTT
GTCACTAAGAATTTGGTTCCTGGTGAAGCTGTTTACAATGAGAAGAGAATCTCTGTTCAG
GTATGAAGTTTGAGGATTGTTTTCTTTATAATTAAATTGAGTTTGTTTTTGTTCTTATAT
TATAGCTACTTCACTTTTGCAGAATGAAGATGGAACTAAGGTTGAATACAGAGTTTGGAA
TCCGTTTAGATCTAAGTTAGCTGCTGCAATTCTTGGTGGTGTCGACAACATTTGGATCGT
AAGTCCATCTATACACATACCACATTGACTCTGTTTTCTTTTTTTGTATTGAAAGACATG
TGCTTGAATTGGTTCTTTGTTAAAACTTTTGTAGAAACCTGGTGCCAAAGTTCTTTACTT
GGGTGCTGCTTCTGGGACCACTGTCTCTCATGTTTCTGACCTCGTTGGCCCTGTAAGTCT
TTCACTAAATTATTATTTTAGTTATCCGTAGGTCCATTTCTATCCTATGTTTGAGACTTA
TCTTTGTTCTATTGCTTTATGATTTGTAGGAGGGATGTGTTTATGCTGTTGAGTTTTCTC
ATAGAAGTGGTAGAGATTTGGTGAACATGGCCAAGAAGAGAACTAACGTTATTCCAATCA
TTGAAGATGCTAGACATCCGGCTAAGTACAGAATGCTCGTGGGCATGGTTGATGTCATAT
TCTCTGATGTTGCTCAGCCAGATCAGGTTTGGTTCTATATTTCTTACTATGAAAGTTTGA
AGTTACCCTTTCTACAGTTTTATTCACAAAGGTTACGTCATATTGCATTGCATCTTTTGC
TTTTAAAATATCAGTTCATTGAAATCGGCATATGATGACATTTCATTTACTATGAAATGT
TTGAAGCCTTTTTATTTTACAGTTATATCTTCAAAGTTTTTTTTTATTGCATTGCATCTT
TTGCTTTTAAAAAAATCAGTACAATGAAATCGGCAGATGATGATTTTACTTGGATTCCCC
TTCAGAACATTTATGGGTGTTGCAAACTCCAAGCTTCTGATGCTACTTTGTATCTTTTTA
CTAAAATTTTTTACTTTGAACATGCAAATCTGTTTTAATCTCAAAGTTTTTATTTGTCTT
CATTTGGTATATCTTATCGATTTGGAAGAAGTCTTTTCGGTTTCTTCTGGTTTTCAACAA
TTGCATTTTCAAGTCATTTAGAAGTTTTACTTTATTACTAAACTTGGAGACTCAATTGTT
GTAGCAATATTGCTGAGCTAGCAGAGATTGCTCCAAGAAATCTGCAATGATTCCATAAAT
GTTTCTATGTTTATGTTAATGTCTCTCTTTATTCTCATTTTGGTTCTCTGTTTATGTTTT
ATTTAATTGAATCCATCTATTTGCCTAACTCTTGAAGGCAAGAATCTTGGCCCTGAATGC
CTCATTTTTCCTCAAAACTGGTGGACACTTTGTTATCTCAATCAAGGTCAGTGCTCTTAT
CCTTAATCAAATTCAACAATGTTCTCCTCTGTTATTATTCAATTTGTATTTCCGTCGCTA
AATAAACATGTCTCATCTGTTCAGGCCAACTGTATCGACTCTACAGTTGCAGCAGAAGCA
GTCTTCCAGAGCGAGGTGAAGAAGCTGCAACAAGAGCAGTTTAAGCCAGCAGAACAGGTG
ACTCTCGAGCCGTTTGAGCGTGACCATGCCTGTGTTGTTGGTGGTTACCGCATGCCGAAG
AAACAAAAGACCCCAGCCTCATAGAGGAACTGTGGACAGTAGTGCCTGTGTATTAAGACT
TATTTACTGGGTTTTGTTTTTATCTCCTTGCTTGTTGTATTAAGCTAGAGATGGATAATG
CTTTTATGTCTCATTTGGAAAATTTTATCCTCGTTTTAGAACTAATATATATTGATGCAA
CATTTTCGTCCAATGATTGTATCTCCATCAGTCTTTTCTATGCTTGTTTTTGCTTGGCTA
TAAGAACTACTGTCCATTTTAATCCTACTTGTTTCTGCATGCTGAATTGATTGTTGAAGT
AGTTTGTTTTGAACATGATTATGCTCAAGAAAAGGCGTAAAAGTATCACTTAGCTCTGAA
AGGAACTCATTTTTTTTTGGTTAATAAAATTTTAAACACAAACAAACCGACTAAGTGTTA
TTGACATAAGTCTCAATACAGTTTCAAGTAATATTCGGCTTCTTCCACTATTGGATCAAA
GTTATAGGCGCCTTCTTCCATCGGTAGCGCATTTTTAAGTATTGCCAATTGGCGTGACCA
ATGAAAATAGTAAGTTTCAAAAGAAAACGGGTAATCAGCAGAGGTAGAATCATTGTGGCG
TCTCAAATCTTTAATTTTCTCAAAACAACGCTTCTCTAGATTCCCGACAAGGTTGATACA
TTGGCGTAAATCGAGGTGTTCCAGGTGAGGACAACCGTCAAGAATGGCGTTTAAGCCTGT
TTTGGTTAGTTTGTTCCCACAAAGCTGGAGATGGCGTAGTTTAGGCATGCTTTCTGCAAT
TGCTATGGCATCATGATCATCATCATCCGAACTTAAGTAAAAGAGGCGGTTTAGCATCAA
TGTCTTCAGATTTGGACAAGACAGCCCTGCAAGTTTCATAGACTCTCCTGACAATGATAT
TCCTGAAACCTCAAGCTCTTCAAGCATTGGAAGTTTCACAACTGCTTGAACAAATCCATC
GTCTGTTATTTCTGAGCACATTAGTCTAAGGCTTCTAAGATTACTTGACCTACAAGTAAT
GGTGTGTAAAAAGTTATAAATCATAATCTTGAGATATCTGTTTTTAACAGACACTTGAAG
ACTTACATGAAAAGTAATCAAAAGTCAAAACTAGAATTAGAGGAGAACCTCTCCGCGATG
TATGTAAGGAGAGAATCACTCCCGAAGTCCCCAATGTTGATCTCCAGCAAGCCACCCTCG
CTACGATCAACGGCGTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1122, 1372..1679, 1762..1857, 1954..2031, 2129..2305, 2977..3045, 3144..3518
1104..1122, 1372..1679, 1762..1857, 1954..2031, 2129..2305, 2977..3045, 3144..3323
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved