Arabidopsis_thaliana Locus Mono:U79-3
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:U79-3
Arabidopsis_thaliana
Mono:U79-3
5
SnoR44-3
1001..1081
2081
GTGTTTGTAGCGTATTGAGGAAGGGATTCGATCATCAGAGAACGAGGCTCCGAAGTGAG
ACACATGCAAAAGAAGTCTTAAGGAGGCTAAAGTCACCTTCTATACCTCAGAAACTATAA
TAGTTAAAACAATTGAGATTAGCGAGTTATGTATTCTATAGTGTCAGCTATCACTCGTTA
TAAAAAAACAAAGAGAATTTCTTGCATGAACTAATACTGTAGTTACTCAAATTGTCCATT
CAGAATAAGATAAGAATCTGACATAATCGGATCTTCCCCTAGGTATGGATCTGACATGTA
AAGTTCATGCATGCACTTGGTGCTTTGATTATCCTCATCCTACATTTGTCAACTTTATGG
GGCCATTTTGGCTCTGCCTCTTATTTATTGAGTCAACGAAGTGGAGATACTCTTCATTCA
CTCTTGAGACATGGATTAGTCTCATTTGTTTTTTTGGCAGAACACACCATTTCCCATCAT
GATCATAAATTCATAATAAGAGACCGAAGAAGTCGTAGGACGAATATAGGAAGCTTCTTG
TTACGTAAAAAATAAAAAGATGGAGATGCGGGGTATCGATCCCCGTACCTCTCGCATGCT
AAGCGAGCGCTCTACCATCTGAGCTACATCCCCATTGCTGTTTAATCACTAAACTATATA
TTTATTACATATTTTATTCTATTAGATAACGGTCCGGCCCGGCCCAACCTTAACTACAAG
AACCAACCTCTTTATAAGTCCGAGCAAACATCCATAACCCTAACTTATCATTCTCTCTGT
TCTTTAGTCTCTGTTTCTAAACGCCGTTTCTTCATTACAATCTTGTTTCTCTATTTTGAA
TCTTATTTCTTTATTGAATTTAGTAGTATTATAGGATTTGGTTGCTGATAGTTGTTGATA
CCTTTGATGGTTTATAACTTTTAATTACTTTGAAGATTTTTTTTCAAGTTTAAAGGTTCT
TTTCAACTTGGTATCATCTGGTGTTTTAGATTTGTGTTGTTTGCAAGTGACGATTAACAG
ACAGGGACATCAGAAAATATTCTGTGTTGACTATAGTCTATAATGGGAATCTCTCTGATG
CATAAAACTTTATCTCATTTATTTTCAGTTTTTAGAAAACCTGTTTTTGATTTGATTTTT
AAAAGTGAAAAAGGCTTTACCAATGATGGATTTCAAAATAATCATCAGATCTGATATACA
TGATTACAATCTTGACGCTGAGGTAAAGCCTTTCATAACCTGTTTTTAAATATACTAGAT
TAGTCAAAACCAAAACTTTCTTATCTGATTGGATTAGATAGCTGATTTCGGATCTAACAA
AACCTGTTAAGAGTTTCTTTACAACAATATTGAAATCTTGCTCTTGAAACTGTGTTAAGA
TCTTAATCCATTGATCTTTCATATTGTAAAAGAGATTGTATTAAAAAAGTTGAAGCTACA
AGATTTATCACAATATAATCATAAGAGCCAAAGATTGATTCAATCTTATCAGTTAATTGA
AATTGCCACTGGTAGTAATGGTGTGAAACTAAAATGAATGTAAGTGCCAAACCAAGCACA
AATAATACTAATATCTACAATTCAATAAGAACCTTAATGAAAAAAGTCATCTCTTTATAA
CACCATCGTTTGATATTGCTCCTCTGTTTTATAACCAATGTTGCTAGCTTGATGCATTGT
TAAAGAATTCATTTTCAGTTCACCAACCGATGCCAAAGCCGCGAGTTCCTTCTCGTCTAA
TCCCTTTGCATCCCCGAGGCTGCATCTTTCACTACCGTGCTTATCCAACGCTTTCTTGAA
CTTATTGATCTGCACATTCAATCAAAAAGAGTTTCAGTTTACTACCTAAGTGCCAATGAT
ATTAAAACCAGCACAATGTTATTTGATCATCAGATATATTTGCTTACAGTTGCAATAGTG
CAGCTGAAGCTACAGACTTTACCCTCTGCTCCTCTATAGAACTTAAAGAAAGGCAGCACA
TGAACGTTTAGACCATGACACATTGTTCTAAGCTCTTCTTGATTCACTTTCAGAAACATC
ACATTTGGGTTTGTTTCTGCCAATTGACATATCTGTTATATA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved