Arabidopsis_thaliana Locus RNA recognition motif (RRM)-containing protein
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana RNA recognition motif (RRM)-containing protein
Arabidopsis_thaliana
RNA recognition motif (RRM)-containing protein
U56
2511..2596
4844
GAATTTCAAATCTTCTTCTCAGATTTCACGTGGTAAACAAAAGAAGAATAAACAAGACA
AAATTGAATAATTTAATAAAGAATAAAAAATATAAAATTATATTATTATGGAAGTGAATG
ATAAATTAAGAAGTTACGAACATTAATTCGAATTTCAAATTTTATTCAGGCTTCACGTGG
TAAAGTAAACACAAGATGAATAATTTAATGAGATAAAATAAATGGGAAAAAGGTCATTTA
AATCACCATTTCGCCATTTGTGGTGATTTAAATCATAAACTTTGTTTTTTGTGATTAAAA
TGATGTGTTGACTTCAAATAAAATTAATAACTTTAGTTGACAAAGCCAAATTAGTCACAT
CCGTACCCACAACTTCTTCATCGACACTAACTTTTTCGTGCAAGTCATCAAGATTTCCGT
CTTCATCTTCACCGTCTTCCTCGCCAGCAGCTTCGTATCCAATTTCATCACAATCTTTAT
CTCAATCTTCGTATTATTCAGTTAACGTTATGACTAATTTGGCTTTGTCAACGAAAGTTA
CTGATTTTATTTGAAGTCAACACCTAATTGATGATTTTAATCATAAAAAGCAAAGTTCAT
GATAAATCACCACGAATGGCAAAGTGGTGATTTAAATGACATTTTTCCTCCTAAAATAAA
CAGAATAGAATATATGATATACTTACAGCTATTGTTTGCTAGTATCCAAATAAAAAATTT
GTACACAATCAATTTATATTCACTATGTATTTTGGTTTTAAAACTCCATATACCTTAAGC
TATATGATTTAGTTTTATGTTTGTTAAAAAGATTCAAGCCCATTATGAGGGCTGAGTTGT
TATATTATAAGGCCTAATTAAACCCAATTAAGATAAGCCCATTGATTCTTATGGCCCATT
GATTCTTATGGGCTTACCGGCAAAAAACATGAATGTTCAACACGTGTCACCAATCGCGGA
GCTACAATGGACGGTGATCATTTTATCGCCGGAAAATTCCCATCTTCGCTTGCTTCCTCC
TCAAAAGGTGAAAAATTAGAGCGAGAGAGATAGAGAGAGATTTCAAAACGAAAATCCAGA
GAAAGGGTCTTGCCAGTTTAGGGCATCCTTGTGGGTGAGAGAGCGATTGAGAGATTTCAA
AAGGTCAGTGTGTGAGTTTTCGAATTTTCACAATGAATCTAAAAAAAGAAGATAAATTTA
GTTTCATTTGTTTCTTAATCGGAGAGAAATTTGTATGCCCCAAAAACAAAAATGATGAAT
TGGTGTTTGATGATGATAATTGTGTGTGAGAAAGAGATGTGCTTGTGGTTTGCAGGAGGA
AGAGGAAGATACGAGTGTGAGAGAGATTTAGAGGGAGAGAAGAAAGAGAGATTCTTTTTG
AGTGTGTTAGGGTTTCATTTCCTCTGCAGATCTACATTTATCTCTTCTCATGGAACGGAA
GCTTGTGGTAATTTGGTTTTCACACGCATTGAGCTCAAGTTTTTAGCTTTTGTTTGAATT
GTGTAACTACGATGCTTTTATATGTAATTTTGAATTGATTTATAGGTTTTGGGAATCCCG
TGGGATATTGATTCCGATGGGCTTAAGGATTACATGTCAAAATTTGGAGACTTGGAGGAT
TGTATTGTCATGAAGGTTTGCATTTGTTTTTGTCTTATTTGAATTTGAGCATTGATTAAG
CAATGTCACGTAGAGCTTTGATATGTTTGATGTTTTAGGATCGATCAACTGGAAGATCTC
GTGGATTTGGATATGTCACTTTTGCTTCAGCTGAAGATGCAAAGGTATATTTATTAGTTT
CAATGAACGTTGGATATTATTGTTTGTACTGGAAAATCTGTCTTAGTTGCTTGTTTCCTT
TGAGTACCTGTAGAATGCTTTGAAAGGTGAACACTTTTTAGGGAACAGGATCTTGGAAGT
TAAAGTGGCTACACCAAAGGTTCGTTACATGGAGTTGTGTGAATTCAGTAAGACATTAGT
TTTTTTACCCGATAATCTTTGTTCAAGGTTATTTTATTCTTGCCAGGAAGAGATGAGACA
GCCTGCAAAAAAAGTGACGAGGATCTTCGTTGCTCGAATCCCTTCATCAGTCTCTGAATC
AGATTTCCGAAGTAATCTTAGCTGCTTTATTGTGTTCTGTTTATTGTTTTCAGAATGGTT
TCTAATAGATGTGGAAAGTATAAACATTCTTTCTGTACTCTTCTTATGCAGCCATTTTGA
GAGGTATGGGGAAATAACAGACTTATACATGCCTAAGGTACTCTATCATTATCTAATTGT
GTGCCTGATAATTCTGGTCAGATCTGTTCTCTTGGATTTGATATCATTTCTCTATTTTCT
ATGTTAGGACTACAACTCGAAGCAGCACCGAGGAATAGGGTTTATCACATTCTCTAGTGC
TGGTTAGTTTTTGGTTAAATCTTCTCCAAACCCGAATTGAGTTTTTATATTTTGATATCA
GAACCTTCTTTACATGTTTGACTGTCAAACTCATGGGAAAGAAAACATAAGAAACTGATG
AATGCGATCCTGGTAATATTTATTGTCACCTGTTTGTAAAAATTTGGATTTAGAAGAAAC
TTTCTATTTTCTGATTTTAGATTCAGTGGAGGATCTGATGGAGGACACTCATGATCTGGG
AGGTACAACAGTTGCTGTTGATCGGGCAACACCAAAAGAGGATGATCATCCGCCTAGGCC
ACCGCCAGTGGCTAGAATGTCGCGCCCACCCGTGGCTATTGCAGGTGGATTTGGAGCTCC
AGGTGGTTATGGAGCTTATGATGCTTACATTTCTGCAGCTACAAGATACGCAGCGCTTGG
TGCCCCTACTTTGTATGATAATCCCGCCACGTTTTATGGAAGTAAGACGACTCACTATAT
AATACCAACATACTAGAAACAAATGAATTTCAGCTCATTAAGAGAATTCTCACTTTGTCT
TAGGAGGGGAACCAACCACAAGGGGAATAGGAAACAAGATCTTTGTTGGACGGCTTCCTC
AAGAAGCATCCGTTGATGATCTTCGCGATTATTTTGGGAGATTTGGCCATATTCAAGATG
CTTATATTCCAAAGGTGAGTTATATAAGTTACATTGTTACACTGAGAACATTTTCAGATA
TTTTTGTATATGTATTGAACATTCATCCTTTTTTAATTAGGACCCAAAGAGAAGTGGACA
TAGAGGTTTTGGATTTGTTACCTTTGCTGAAAATGGTGTTGCAGATCGTGTAGCCCGAAG
ATCTCATGAAATCTGTGGACAAGAGGTAAAAAAACAAGCTTGATACTTGATGCTTTAGAC
AAAAACTTATCTAAGATGTATAAAGAAGCTACACTGTTTTGATTTTCGGGTTTAGGTAGC
AATAGATTCAGCAACGCCTCTTGATGAAGCTGGACCTAGCGCTGGCGCAAGTTCCATGTT
AAGTTCTTCTCGTCCTGAATATTTTGGTGGCTATGGAGGTCCTATGCGCGCATTTGGTCG
AATGTATGGAGGCATGAGCTTGGACGATGTGAGTATATAAATATATATAACTAAAAACAC
TAATCAAAGATTCTTTTTATACAAGTTGGTTCTGATTCACTGCGTTTTTTAAACTAATTC
TGCTAGTGGGGATATGGAATGCCAAACGCAAGACCATCAAGACCAGACCGGAGGTACCGG
CCATACTAATGCAGCAGACCAACATTTCATTAGCTTTGGCTTTGTCTTTTTATAGAAACT
TCACTTTGTCAGATCTATTTTAATTGAAGCTTTTGTTTATGTTTTACCCTCGGAACCAGT
GAACCTACTTTGTGTGGTGTATTATGCAAACAAGTAAAAAGTTGGAACAGAGAAAGCTTT
ACAAGAAAAATTCGCAGTGTACATTTTTTTTTCTTTTGATCAAATTGTCTTTTCAATAAA
AAAATTCAGAGAGCAGAAGAAGATTTTCTGCAATCAACACGAGGAGCAAAGCAAGTCATG
AAAGGAGTCATGAAAGTATGTCTTCGAACAAGATGCGTGATCTTCACCGAGTTTCTGGAG
ATTTGATGATTCCCTTGTTGTTGTTCATGTTCACTGGATACTGAACTTCTCCTCATCTCT
TGTGCTTTGATCTTAGCTGTTTGAAGCTTGTTCAAGATCTTATCCATTGATGCTGATTTC
TTCTTCTCCAGCTTCACCTGTTTGATTCAGTCAAGCCAAATGAAATTTCAATACATAATA
ACCTCTGATTGGTTTGTGAGGAGCTTATGTAAGTAAGTGAAGGAGGACTGACCTCAAGTT
TTCTAATAGCGGCTTCTGCTTTCGCCTTCTGCAGATTTTCCCAAGCTGCAATCTTCGCTT
CCTCTCTTTGCAACCTGCAAATACTCACATTAATGGCTGACCAAGAAGAAAGCGTTATAA
AAAACTGATACAACAACTTTGATTACTTAGAAAGAGTCATGGCTGGTTCTGAGATATCCC
AAGAAGAAGAAGAAGCAGAAGCTTCAGAATTGTCTTCAACCTCAGGTTGCTCTCTCCTAA
TAATCCTAGAAGACATGACTCGTCTCTTTGGACGCTTAATCATTCTTGCTCCTTTATCCA
TTTTCACTTCTCTCACTTCACCTCTACAAGGAGGTGGCTCAATCACAGAAACAACCAATG
GTGGAGACTGGTTATTGTTATTAGGACTCGTCTCTTCTGGACTCATCTGAGTAGCCATAT
CTCTTCTTGATACCACCGGAGATTGCATCGCCGTCGTCATCTCTGCTTTCTCCTCTACAC
AAATTTCAGAATCAAACATAGCTTAGATCTTTGAACATGGTTTCATAAGAACCAGCTCAA
GCTTGAATCTTTTCATGATTCTGTGATTCAATTTGCCAAAAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1142, 1315..1447, 1546..1634, 1718..1783, 1873..1938, 2026..2110, 2210..2256, 2347..2401, 2600..2860, 2943..3073, 3160..3264, 3355..3507, 3606..3844
1429..1447, 1546..1634, 1718..1783, 1873..1938, 2026..2110, 2210..2256, 2347..2401, 2600..2860, 2943..3073, 3160..3264, 3355..3507, 3606..3844
NC_003075.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved