Arabidopsis_thaliana Locus DNA-directed RNA polymerases I, II, and III 7 kDa subunit, putative
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana DNA-directed RNA polymerases I, II, and III 7 kDa subunit, putative
Arabidopsis_thaliana
DNA-directed RNA polymerases I, II, and III 7 kDa subunit, putative
U19
1197..1340
2903
TCAATTGTAGGAAATAATGGTGGAGTCATTGCCGGTTTAGCAGCATGTGGCATTATGAT
GTCAATCGTCTCAACTGCAGCGGATCTCATGCAGGATTTTAAAACAGGTTACCTCACACT
ATCATCTGCAAAATCCATGTTTGTAACTCAGCTTTTGGGTACAGCAATGGGTTGCATAAT
CGCTCCTCTCACGTTCTGGCTGTTTTGGACTGCTTTTGATATTGGAGATCCTGATGGTCT
ATACAAAGCACCTTACGCGGTCATCTACCGCGAAATGGCTATTCTCGGGGTCGAAGGCTT
TGCCAAACTGCCCAAACACTGTTTGGCACTTTGTTGTGGATTCTTCATCGCTGCTCTGAT
TGTAAATCTAATTAGAGACATGACACCACCAAAGATCTCTAAGTTGATACCACTTCCAAT
GGCAATGGCTGGTCCATTCTACATAGGAGCTTACTTCGCCATCGACATGTTCGTAGGAAC
CGTGATAATGCTCGTATGGGAACGGATGAATAAGAAAGACGCAGATGATTACTCGGGTGC
AGTAGCTTCAGGTCTGATCTGCGGAGATGGAATTTGGACCATCCCATCCGCAATTCTTTC
TATATTAAGAATCAATCCACCCATTTGTATGTACTTTAGACCATCCTAGACATTGTTATC
ATGTTAAAAATTTGTTGCATTATGGCAGATAATAGAGTTTTTATATCTCACTCTAGAACA
CAAAGTGCCAATAGCAACAAGTATGTGGCATAAAGTCAAACAGACAAGGTTGACCAACGA
AACTTTATTTGGGCTTATTCTGTAAGCCCATAGACTTTTGTTAAGAAGCCCATACGAATC
TCTTTCCTCGTCTTTTCGACCGAAATTATTAAAACCTCTAATTCCTCCTCAAAAACCCTA
AAATCCCAATTGAGAAAATTTAGACGCTCAAGGTTTTGTTTACATCTTGTCCGGTGGCTT
GAAACAAATTCAACTTCTGCGTACTGTTTCTTTGTTGAATCATGGATCCAGCGCCCGAAC
CCGTTACTTACGTCTGCGGAGGTAAGCTCGACTTGAAAACTTCATCGAACATCTAATTTT
GCTTTGAAATCAAAGTTTTGTTAGTATCTGTAAAAGATTGTAGCTTTGTGAAAGTAAATG
CTAAAGTTGCCTCTTTTGAGTAGCCATATGAATCCTAATCTATTAGGAAATTTCATAATC
TGGCTTAGTTAGGAGGCATAAATCAATCTTGATCATCAATACTTTACTGTATTGTATTGA
TCTATTTGACTTGAGGTCTTTTTGAGGAGGAGCTTTGCTTCTGCTAAGTATCAAGCTTCT
CCCAAGCAGCCTCAGACATATACACTTTTAAACCAAAATTCATAAGTAAAAAGGTTGTCT
TCGTTTTATGGGTTTGCTTAATTTCTTATTTTCTGTATCATCAGATTGTGGTCAAGAGAA
CACTTTGAAGTCTGGGGATGTGATCCAATGCAGAGAGTGTGGGTACCGTATTCTCTACAA
GAAGCGTACCCGTAGAGGTGACTTATTCTTAATCCTCCTTTTGTTTTGTAATGTTTTTAG
CTTTCTTTGATTCCTCTTTTTTTGGATCTTGTTCCTAGTTTATAAAAGTGATGGCACCAT
TTTGAATGCGTCTCAACATATACATGATATCGGGATCCTTTTTTAAGTCTTGATCATAGT
TTATGATACTGATGGAACGATTTTCAGTGTGTCTTATATAACGCAAATGTTCTAAGGATC
CGGTTTCCGAATTTATCTTGAGATTGTTAATCTGTTGGTTTTCTTGTACAAAATGTAGAT
GTTGTAAACTTGTTTCCGGCTAATTTATTTGATGGTTTATTCTCTTGCAGTTGTTCAATA
CGAAGCTCGCTGAGAACTACTACTCCTGAAGGTGGTTCATAGTCTGTTAAGATGGGTTGA
GACTTTTTGGCACTGTTTGTGATATATATATCGACATGGTGATTGCTACATTGCCAGTTC
GATTTGATTTGGTCACAGTGTGACTGTGTAATGACTTTACCGTTTTGATAGATGTAATTC
TTGGAATAACTAAGTTCACATTGCTATAATCCTTGATTGGCTATAATCTCTCGTTGTTTT
GCTACCTTTGTTCTTTAGTGTACTCTGCATTTAGTTGATCAGATTCTGGTGGTGGAAAAG
GTAGTGACTACCATATATCAATCTTGTTTGCTACATATTAAGTGTTCGGAAGAAATCGAA
GAGAGACATGAAGAGAACCCACCACAATGTTACTCTCAAAATACCTTTTTAGTACCAAGC
AGATGGATAAATTAGTGTGTTAATATCTGTCTAACGAAACCTTTGGTAAGTCCTATAGGC
TATGGCTACAAATAGAAGAGTCAACACAAGAGAATAATCGCGGCAAATATGCTCTCTATT
AGCTTTCATCAAATACAAACTATGAGTTTTCAATCTCATGATACATTTATCTCGAATACC
AAATGCTATGAAATAATCTATACGTTACTAAATACTAGTACTCTCTTCGGGTGGTTACTT
CACTATTTCATATCATTCATTACCGAATTTACAAGCCTTAATTGCCATTGCTATCGTCCT
TGGTGACTGTATCTAAAACCTGGCTAAACTCATTGTTGTCGCTGATAAACTCTTCCAACA
AAAGCTCCAAACAAAACCAACTGTAGCATTTTTTTTTTTTTTTTGTCAAAACCAACTGTA
GCATTTATATAATAGTCTGGGTTATCAAAATCAAATACATTCTCAGAGTTTCTATCTGCT
GACATAAGAAAGTACCAACACATATTATCAAACAATAAAAAGTACCGAAAAACATGTAAG
GTATGGTTCCAAACTTAATCTTCAGGATCATAGGGTCTGTTGTCAAAATCCTCTCTGTCC
TCAGCTATGTCAGGGCAATACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 1424..1516, 1850..1903
1001..1040, 1424..1516, 1850..1872
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved