Arabidopsis_thaliana Locus mono:SnoR96
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana mono:SnoR96
Arabidopsis_thaliana
mono:SnoR96
SnoR96
1001..1052
2052
AACTTGAATCTCTAGTTTCACAATGAATTAACTAACAACTTGATTTCATTGGACTTAAA
AGGGGTTGTGGTCGGATGTTTATCAACTTAGTCAAGCGATATATGGATCTTTATACCCTG
AATTTTGATCCTAGGCTTCGGCCTAATGCTTAATCGGTTAATCCAATAGTAGACTTGCGA
GAAATCATGCTAAATGGGCCCTTGAGAAAGAAAAAGAAGAAAAATCAAACCAAACCGAAA
TCTAAAATACAATTAGACTTGTAAACCAAATTGAACCGGGAAGATCATGTGGGAGTCTCG
AGGCTGCCTGTTTCAGACAAGTTGCTGAATTGTTTAATTCACCGGGTAGCTGCCCGCTGA
CCAAACAGATTTCCTTCTTTTCTTAGAAAATTGCCTTTTTATATTATTTCCAATTTCTGC
CTATTTCCATCGACCGACTAATAAACACCATTGACCTAATTTCCAAGCCTCTCTCTATAT
AAACCAAACCTCTTTTGCATATACCTTCATTATCTTTAGAAGCCTCCTTTGTCTGTCTCC
TCCTTATTCGATATTTCTCTTCCATGTTTTTCGTTCTTTTTCTTTTTAAGTGGTAGAAGA
TATTCTCTAACTCCATAAACTTATGTGTTAGCTTGTTTACACGTTGGTGATAGTTGATTG
GTCAGTTAGAGAATAGATCTGGATCTTGTTCTAAAAATGTTACAATCTTTCTAATATTTA
GATTTGCAGCTGTTTATTTTTGGTGTTTTATTGAGGTTTCATTCCAATAGTCGTTACAGT
TTTATTGTATTTCTTAGTCAAGATAGGAAGCTTTTTATATGAGATGGTATATTCGATATG
AGAAATTTACACAGTAGTGTATACACTTACGTATGATGGTGCAAAAATCTTCCATCCGCA
TGTCATGTCGTTTTGGTAGGCAGAGCGGCCATCTTTTGCACATATTAATCTTTGAGTGCC
TTTATCATGTTTGACCCTTCGGTATGTAAAAGATCGCTATTTCAATATCTCTTCAGTAAT
ATTGAAATCGATTTTTTACCTTGGCATACAATTTTGAATTTTCTACTTAACAAATTGTTT
TGAATTTTTTTTAATTGTTTTAGACTTTTAGGCATGTTTATTGTTGTACTTTGGTTTACC
AATTGATTTCAAATAAAGGGTTGTATAAAGTTTTTTTTATTAATATCGATATCTTTTTGT
GTTAAATATAATTACATTCCTGGTGCCTTGTGGAGAAGTTTTATGATATTTGATTGATAT
AGACAATATTTGGGGACTTGATTATTCCAAGACGTTGACAGTTTGAGGTAGTTAAAATGT
TGGGACTTAGATGAAGTTTATGCAGCCACGTAAAAAGACATGAATTTGAACAGAACATTA
TGGACCTTTTTTTAGACAAGGAGACATTCGACCAAAAGTGATATGTACATACTATTTTTA
GGAAGAAAATCCAATTACCACAAATAGATTAGCTTTTGACAACTTTTCAGTTACCCAATA
ATTCCAATTTCCAAATGTGTTGGGTAAATTGAGGCGTCACAAAGTACCTCAAATTTTGTA
ACTGGAATCAGATCTCCACTTGAATCTTTTAAGTTTCAGAATAACTGGATCCCTAAGTAA
AATCTTTAAAAAGGTAAAGGATTTTACAGTTAAGAACTCGAGACAGATCTGTGTTATTCT
CTTCTCTGTAATAATAATAAGAAAGATGTTTTCATACATCAAGACTGGTTTTGGGAAGGT
GATGATAACCACATGAGGAAGCTAGATATAGACCAGATTGAAATCACACCCAAAACCTGT
ATCACATTCAAAAGTGTGCCCAGTGATTTCTTGATTGCCAGATTATTAACTGTTGCCTCT
GCTCCTTTAACCGTAAATGACAATGCTGTTACTAGTTGCGCCGCTCGGTTCAGCTGATGA
AGTCTGTATACCTACAAAACCCAAAAAGGTTCCTTCAAAAGTGTGTTAAAGTGAAATATC
TTTTGAGAGGTGTTGATTGAAGAAGAGTGATCACATACCTGAAAGATGATGGGGATGATA
GGAGATGATGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved