Arabidopsis_thaliana Locus Poly:SnoR95
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR95
Arabidopsis_thaliana
Poly:SnoR95
SnoR95
1001..1135
2135
TATTACGACCATACAAAAAAAAATCGTTAAAAAGAAGGTAGAAATGAGACTAATAAGAG
CTGAGCAAACAAGTTTAGTCGACTGTCGACATGACCAATCTTCAAATTAGCCATCTTTAG
TTCTTTACTTATGTTTGTTTTGGTCTTTTTATACATCACGGATTAATTCACCACGAGAAC
ATTATTATAGGAGACAAGATATTATTTCTCAACTATTATAATTCTAAAAAAAAACATTTG
TAATTGGACTCGGCCCAAAATAACATTACCCGGCCCTCGATTTCTACTGAAAACTACCGT
CAACAATAAAACGACATGCAGTTGCTTATTAAAGTGATAAAACGACAGAAACATTTAATA
ATCAGAAAAAAACCCGACCCGGTTCTTAACCTAATCCAAGTTGTTGTCTTCTTATAAAAT
GCTTCCATGAATCACTAATCCAATGCAGCCGTCAACATTATCGATTTCGTTATAGGATCG
TTTTCAATTCTAGTAAAATTTGTTGATTTATGGGTGTATGCTCAATTTCTCTTCTGTGTA
CAAAGTTTGGATTTTTATCTTGATTTCTTGCTATAGTAATTAAAGCACTGTATAGCCCCT
TGCATCTTTGAGATTTATAGATGCAAGGAACAAATCGAGAAAAAGGTACTCAATTGGTGC
TATATTTTGGCTTTTTACGCTTCTTTTGTTGGGTTGTTCAATAGTTGAGCTTCTCAGAAA
TGTGTATTGGCCAATAGCTGAAATCTGGGTATTGAGTGGTGTTAGTTTGTTTAATTTTGT
ATTGAAAGGAAAACAGAGCATGATGATGAGAAAAATGTGCCACTGAATTCAAAATTCATG
TTGATATATTTATTATACAACCTTCAAAGTTCTCTGAATTGCTCTGTTTTCTCTTTTCAA
ATCCGGTTTTTATCTGTTTTATTGGCTTGTCCTTTGTTCATGTGGTTTTAGAATTAAAGT
ACTGAGAATTGTTCAGTTTTTGATATGCACCTAAGAAAATCATAGTCTGTGTTAACTGAT
TTAATGTTTCAGACTACACGAGCATGGTGCTATATGAAATTTCTTCGATGAGTTTTTTAC
TCATGCCATATATTAGCAGTTTGCTAATATATGGCTCAACTTTTGAAGATACATTGTTTT
TGGTATCTCAACTCTTTACGAGTGAACAATTGAATCTTGTTTCAACATAATCTGGTTGAA
TCTGATCTCTGATAATTGAAACGGCCGCATTAAGAGTTAAATCGAGATGGAGGAGTATTG
CTCAAACAATAATGTTATGAATTACCGGACTCAAGCCAAAAATGACATGTTCCGCTCTGT
GGTTTTAGATTCATTGATTAAAGTAATCGATAATGGTTTGTAGTTGTACAATCAAATACA
CTCTTGGGATGTTCAAATTGCACAAGCATCACCAACATAATCAAAATTACAAGACTTATT
TTATATGAGATCTTAAATTTGTCAGCACATTGATTAGCCATAAATATTTCCACAAATGAT
CAATTTGCTTATACCTTGCAATTGAGACTATGCATTCTCAATGAGTCTGTGACTAAATTA
ACTCACTCTTCCTTTTCATCTTCAGTTTCTCATGAAATGGGTACTATATAGAACATTCAT
TCGAGCCAAATGCGGTTCTTTGACAATTTCTATGATTAATTTATCATCATTTTGAAAACT
TTTGCGAGAGATTAATCGAGACTACATGTTAACTATTGGACCCTCTTGAGTGTTGAATGG
GTTTCTTTCTTCTGTTGGGCCCGAACCAACAAAATTGCTTACTATAACTCGGCCCAACAC
CAAAAGTATAGGAAGAGATATGAGATCTTTTTCCCACCTTATAATATAATCTTGCTACTC
AATCTCAGAAGCTGATAATTTTTTTTGTAGTCCTTGCTCTTTTTAACGGCAATGGCTTTC
TCACAAGCTGCTCTCTCTGCGTTGCCTCTTTCTGATCGAACTTTCCGCAAAAAGCCATCT
TCTTCTTCTTCATCTTCACCGAATTTCGTTCTGAGAGTAAGAGCTGCTGCAAAAGAAGTT
CACTTTAACCGTGATGGCTCTGTCACCAAGAAGCTTCAGGTTTTCTCGTTCTTCTTTCGG
GCACTTTTATAGAATTTCGTTTTCTTATGATGGATA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved