Arabidopsis_thaliana Locus Mono:SnoR94
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR94
Arabidopsis_thaliana
Mono:SnoR94
SnoR94
1001..1101
2101
TTATTTAGAGTACATTATTATAAAGAAAATCACATTACATAACATTAATTAAAAATATA
TATTTATGATACAATTATACACATATAATTCTCCCACAAATGATCTTTAATGCGACTAGG
GGTAGGGATGGACGTTTGGGTTCAGATCGAGTATTTCGGATTCTTGGTTTTTCGGATTTA
AAGGTATACAACCCGTTCAGATAATTTTACCGACTCGGATCAGATATTTTGGTTTATGAT
TCGGATTACCCGAAATTCAAAAATAACCAAATCTATCCAAAATACTCAAAGTACACAAAA
TATCTAAAAACCTTGAACATTTACTACCCAAATTTACTCAAAAATAGATTAAATACCCAA
AAATATCTAAAATATCCAAAAAATCCTAATATTTTTTGAAACTAAAATTATTACAAATAT
AAATATTAATAATATATTATTATTATGTACTTAACTTATGGGTATGTTCATATATCCGTT
CAAATACGATTCAGATCAGATTCAGATTCGAATTTTTGGATTTGAAATTATAGAACTCGT
TCGGATATATTAAAATTTCTTGTTTGGGTTTTGCATCAGGTTTTTCGGATCTAGTTCGGA
TTCGCATATTATACCAAGAATAACGTAGAAAATGCCTTATTTATTTTATTTAATAAAAAA
AATTAGATATAAAAGCCCAAACTAAGAAACATCTGAAAAGACCAAAATGTTTTTAAAAAG
CAAACTGAAACTTGGGGCCGGAGATGTCCAGATTGAACATTGAAACATTGTAACTGTGTA
GGGGTGAATAACGAAAGAAGAGATAAATACATGGCTCAAAATGTAAAAACAGATAAATAA
AGGGGTGGATTCAGAAATAAGGGAAAGAAGAAGGTGTATATAAAACCAAGAAACCCTAGA
AGAAGAAAAAACAAATTAGTGCCTGAGGCCGAGCGCTTCCCTCTTTAGTGAGGGGTGGCG
TGGTATACCACGAGAAGGGATTACTGTGGCGTACCCTAAGGGGTGCGTAGGCGCATATCA
GAGAATCAGGGCTCTTTCTCTGCTTTGCTGTTTCCTTTAAGCTTTAGGCTGTCAAAGCAG
AGACGTTCTTTGCCCTACATTTTTTGTTTTTCGATCTCAATCTTTGGTTTTGAATTCTTC
AGATTATTTTTGGTTCTTTTACGAGTCTTTTGATGTTGATGATTAGTCTTTTATTGAGAC
ACTAATTCGCAATATGTTATATTGATCTTCGATAACCTTTCTTTGGTTCAAAATATTCTT
AGATTTTTAAAATGGTGATTAGGTTTTGGTTAATTTTGTTTTTGGTAATCGTCGTTGTTC
GTATCGTTGTGCCAAGATTTGGTTATTTCCGGTTATCTGTGGTTAAATATCGGTTATTTA
TTGTTCTGGTATCAATCATTCAATACATTGCAAAGAGTTCATCAATCTGAAAATGGTAAT
TAGTTTTTGGTTAATTTTGTTTTACCGGTTCGCGGGTGTTCGTATTGTTGTGCCAAGATT
TGGTTATTTCCGGTTATATGTGGTTAAATCTCGGTTATTTATTGTTCTGGTATCAATCAT
TCAATACATTGCAAAAAGTTCATCAATCTGAAAACGATTGATATGCAGTGAAGATATATT
TATTTAGAACAAGATCACAAACAGTTTAAACTCGAAAGAATCATATAATTGGTGATCTGT
GTTCATTAGTTAACTTTAGTGAAATGTAATTAATCAGCAAAACATTACATAGTCGATGAT
TCATGAATTGTATCTTAACTAAATTTCAAGTCAAATAATGTGAGAGCAAAAGTAGATTTG
CAACATTACAAAGGTATGAACATTTTACAAGAACATAAATGAGAAGAAGCTCACATTTTT
GTCTCAGTAAAATAAGTTGATGAGACAGCTAAACCTTCATGGTCATATGTGCGGATGAGT
CTTTGTCTTGAGCTCGGCGATTCAAGCCAGCAGAATTCTAAGTGGAAAGACTTTAAATCA
GCAACACACTTTGATACGTCGCAAGGACATCCCATGTACATACCTCCGGGTAACAGAGTC
ATTTGGTATCCTTCCGCGAATGTAACCAAGTCTTTCGACATTTTCCCTTCCCAGTGCACA
TT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved