Arabidopsis_thaliana Locus heat shock cognate 70 kDa protein 3 (HSC70-3)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana heat shock cognate 70 kDa protein 3 (HSC70-3)
Arabidopsis_thaliana
heat shock cognate 70 kDa protein 3 (HSC70-3)
SnoR93
1434..1555
4526
AGTGATATGAAAGACATTAGTCTCATCAACAGTTCGAGTTCAAGTAGAGATCGAGAGCA
TTAATCACAAGCTGCACGCTTCATGGTTAGTATTGTTTCCTCTTCACCAGGTAATTTCCA
TGGCATAATCAATTTGGTCCTACTCTATCATATACTTGGTACTTGTACACCTATTTTATT
TCCAATTTGTGGCTACAAATTTCTGTGCCACAAAAATTCGTTTTTTTTTCAATAGAAATT
TTAATCTGAAAATGAGTTCCCTTTTTTTTTGGTTGAGTTTCTATATTGGTTATTTCATTG
CATTTATAAATTATTTTCTTTGAGAATGTTAAAGTTATTACATAGTTACGTTACGTATAC
CGTCCACTTTGCATGCTTCTTCCACGTATTGTTTGGGGCTTATTTTAGCTATCAAAAGAG
GAAACCCAAAACTCTTTACTCTCTCGTCAATCTCTTTCAATTGTGTGTACAATTCTTTGG
GCTTATTGTGAATATAGCTCGAGCAACTCAAACTATTCAAACTCATGGACCATGTCAACA
ACTGCCCTGAATTATCATTTGTGTAAAAGGCAAAAACCTATGCAGCATACAATAAATAAA
CACATTAACTTTTTCTTGTTTTTCAAATTTTCTCCAAGATAAGCCCATTGGGCCTACAGC
TAGTTTTGGGAAAAAAAACAGAAAAACGAAAAGGAAAAAAGCTATCAATGAGTCACTGAC
GGTGAACGGTGGACCGACTCAAAGCCAATGAGAACGCAAGAAAATGTTGAGCCAATGACC
GACTTTTGATTATGGACTAAGCCATCGAACCGAACATTCTCGAACCTTTTTAAACGGCTT
TCCTTATTTGTTAAAGGAAAAGGAAAAGTAGGAGAAAAGAATCATTCCTGGACCGTCAGA
TCCAACTCCAAAAGATCGTGCGGTTACATAGCGAGCCATCGAACCTTCTCGAAACTCGAG
TACAAGACTCTATATAGACTTCTCCTTCGACCTGATATTTTGGAAAAAAGAAAACAAACC
TAGCCGCAATTCACAATTCCTCTTTCACAATCTTTCTTTCGATTTTTTAGCTTAATCCTG
AGTAGCGTTAACAATGGCTGGTAAAGGAGAAGGTCCAGCGATTGGTATCGATCTCGGTAC
CACTTACTCTTGCGTTGGAGTTTGGCAACACGACCGTGTTGAGATCATTGCTAATGATCA
AGGTAACAGAACCACACCGTCTTACGTCGCCTTCACTGATAGCGAACGGTTGATTGGTGA
CGCCGCAAAGAATCAGGTCGCCATGAACCCGATTAACACTGTTTTCGGTACGTTTCACTC
GTTTCCTCTTGCTAAATTTGTCTTTCGAACTTGGATTATAAGTAGATCTGTAATCGGTAG
ATCCATAGCGATGATTTAGGGTTTCATAAGAATGTTTTAACATTGCTGGAGCTAGTGAGA
TTCAATTTTCGATCTAATGTTACTAATTTTAGCCTTTAGGCAAAATATACATATAGCATC
GTTTTAATTCGTATAGTATCTGTGGTCTAATTGTGTTCAATTTTGTTGTGTGACAGATGC
GAAGAGGTTGATTGGTCGAAGATTTACTGATAGCTCTGTTCAAAGTGACATCAAATTGTG
GCCCTTCACGCTCAAATCTGGACCTGCTGAAAAACCAATGATCGTCGTTAACTACAAGGG
AGAAGATAAAGAGTTTTCTGCTGAAGAAATCTCTTCTATGATTCTCATCAAGATGCGTGA
GATTGCTGAAGCTTACCTTGGTACAACGATCAAGAACGCTGTTGTTACTGTTCCAGCTTA
CTTCAATGACTCTCAGCGTCAGGCTACTAAGGATGCTGGTGTTATTGCTGGTTTGAATGT
TATGCGTATCATCAACGAGCCTACTGCAGCTGCTATTGCTTACGGTCTTGACAAGAAGGC
TACAAGTGTTGGTGAGAAGAACGTTTTGATCTTTGACCTTGGTGGTGGTACATTCGATGT
CTCTCTTTTGACCATTGAGGAAGGTATATTTGAAGTGAAGGCGACTGCAGGAGACACTCA
TCTTGGTGGTGAGGATTTCGACAACAGAATGGTGAATCACTTTGTTCAAGAGTTCAAGAG
GAAGAACAAGAAGGACATTAGTGGAAACCCGAGAGCTCTAAGGAGGTTGAGAACCGCCTG
TGAGAGAGCGAAGAGGACTTTGTCATCTACGGCTCAGACCACCATCGAAATCGACTCTCT
GTTCGATGGTATTGACTTCTACGCTCCTATCACCCGTGCCAGATTCGAGGAGCTTAACAT
AGATCTCTTCAGAAAGTGTATGGAGCCTGTTGAGAAGTGTCTTCGTGATGCTAAGATGGA
CAAGAACTCAATCGATGATGTTGTCCTTGTTGGTGGCTCAACCCGTATCCCCAAGGTCCA
GCAATTGCTCGTTGACTTCTTCAACGGCAAGGAGCTTTGCAAATCTATCAACCCCGATGA
GGCTGTTGCATATGGTGCTGCTGTCCAGGCAGCTATTCTCAGTGGTGAGGGTAATGAGAA
GGTTCAAGATCTCCTCTTGCTTGATGTCACACCACTATCTCTTGGTCTTGAAACCGCTGG
AGGAGTCATGACTGTCTTGATCCAGAGGAATACAACCATCCCCACAAAGAAGGAGCAAGT
CTTCTCAACTTATTCAGACAACCAACCCGGTGTTTTGATCCAAGTCTATGAAGGCGAGAG
AGCAAGAACCAAGGACAACAACCTGTTGGGTAAATTCGAGCTTTCTGGTATCCCTCCAGC
ACCAAGAGGTGTTCCTCAAATCACTGTCTGTTTTGACATTGATGCAAACGGTATCCTCAA
CGTCTCGGCTGAGGACAAGACAACGGGGCAGAAGAACAAGATCACAATCACCAACGACAA
GGGAAGATTGTCAAAGGACGAGATTGAGAAAATGGTTCAAGAGGCAGAGAAGTACAAGTC
GGAGGATGAGGAGCACAAGAAGAAGGTGGACGCCAAGAATGCTCTTGAGAATTACGCATA
CAACATGAGGAACACAATCCGTGATGAGAAGATTGGCGAGAAGCTTGCTGGAGATGACAA
GAAGAAGATTGAAGACTCAATTGAAGCAGCCATTGAATGGCTAGAAGCGAATCAGCTAGC
AGAGTGTGATGAATTTGAGGACAAGATGAAAGAGCTCGAGAGTATTTGCAACCCGATCAT
AGCAAAGATGTACCAAGGCGGTGAAGCTGGTGGTCCAGCTGCAGGAGGAATGGACGAGGA
TGTTCCTCCTTCTGCCGGAGGTGCAGGTCCCAAGATTGAGGAAGTCGACTAATAACTTTC
TCTCTTACTCTCTTACTCTCAGTCTTTATGTGTTTGTATTTCAACATTTTCCTGTTTTGT
CCCCTAGTTTTTTTTTTCTTTTTCTTTCTTGTATTGACTCTATTTTGAGGGCTCGCTTGT
TTCGATGAGCTCCTTATTTTTTTTAATCTATAACAGGAATGTTTTGATTAATTCTGCAAG
GTTTTTATTCTTTTAGCCTTTTTAACTTAAGAAAGATACTTTATCTCAAAAACAATGAGA
TACTGTAACCGCATGATTCAAGTCTCCCTTTGGAACTCTGGTGAGTTGCTTTGGAAAAAG
CTTGCTGAGATTCAACAACATAATCATCTAAGATTGACTATTATCTGTGATTTGTTGATT
TTAGAATACTCGACACAAATCATAATCCACCATACTTCAGCAACCAAGTTCTATTCGTTT
ATATCGTATGATTTCAAGAGTTAAAAACCCATAAAAGACATCGGTTGGTGTGGGTTTGAT
AAGGTTTAGCTTGGGATTGGCAAGGTCGGGAAATACATTTGATGTTGTCTGATCATCGTG
GAAGCCCAGCTGGGCTTTCTCGATATTCACCGATTCCAAGAAGATCCTGCAGGAAAGAAA
AAAACAGCTTCTTAGGGAACAGCTTCTGGATGGTAAAGTGCAAGATATCAGTGTGTTGTC
TTGTCTCTTTCAAATATGCAGGACCTTTAGGCTAAAACCTCTACATGTTAAGGTACTTGA
TTCTCTAAGCTTCTTTGTTTCCTTGAATATGCAGATGTTTAAGATTCAACAAGTACAGTC
TGTGACAAAATGACATAGCAACTTGCTCAAGTAACTGGAGCATTAGAAGTGGAAGTTTAC
CTGACAAGCCCTGTTTTTGGCTCTGGTCTCCGCTGTGCTAGGGATATCGTGATTCGGTTT
AAGAAATTTCTTCTCACGTCGCTCACAAGAACCCCATCCGTCAGCGAATCTTCCTCCACT
GCGAGACCCCATCAACCAAAAGGTTAAACACCAATTAATCACTACACACTATTTGCTAAA
CACACCATCAAATTCAAGTTTATATAGAAGAACATTACTGCATAATGGCTCGAACGATGA
ACTCAGCACGCTGGACATTTCTGTTTTCGTCGAATTCAATAGTCTTGTCTCTTATTTCAT
AAGACACATTGAAGTAAAACGATATTTTCCTCCAACCTTCACATTTCCATACAATGTAGC
ATCAAAACCAATTTTGAATGTAAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1306, 1556..3526
1093..1306, 1556..3291
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved