Arabidopsis_thaliana Locus UBQ1 (EARLY-RESPONSIVE TO DEHYDRATION 16, UBIQUITIN EXTENSION PROTEIN 1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana UBQ1 (EARLY-RESPONSIVE TO DEHYDRATION 16, UBIQUITIN EXTENSION PROTEIN 1)
Arabidopsis_thaliana
UBQ1 (EARLY-RESPONSIVE TO DEHYDRATION 16, UBIQUITIN EXTENSION PROTEIN 1)
SnoR91
1702..1743
3304
CTCAGAGGATGTGACTCCAATCCCAACCGACAGTACCCGCAGAAAGGGTGGAAGAAGAG
GAAGGAGGCTCTGAGTTATTTGGCCTCTCGTTGGATCTCCTTATGTAGCTTTCTCAATGT
TTCATTTTGTTTTTTCTTAGTTTGAAAAGAGTTTTGGAATTACTATGCTTTGTTATAGTC
TCAACTCTGAACAGCTTTGGATCTTTTTCTGTATGACCATAAGATATTCAAAAATTGGTA
GTCATTTTATCTCACAAAAAAACCTTGAATTTGTGCTGTATGATTTTGTAAAGTCTTAGG
TGCCAAATCTTTGATTGGAGTTGATAAAATATTTTTATTTGGTTGTAATTTTGTAATATC
CCGGGATATTTCACAAATTGAACATAGACTACAGAATTTTAGAAAACAAACTTTCTCTCT
CTTATCTCACCTTTATCTTTTAGAGAGAAAAAGTTCGATTTCCGGTTGACCGGAATGTAT
CTTTGTTTTTTTTGTTTTGTAACATATTTCGTTTTCCGATTTAGATCGGATCTCCTTTTC
CGTTTTGTCGGACCTTCTTCCGGTTTATCCGGATCTAATAATATCCATCTTAGACTTAGC
TAAGTTTGGATCTGTTTTTTGGTTAGCTCTTGTCAATCGCCTCATCATCAGCAAGAAGGT
GAAATTTTTGACAAATAAATCTTAGAATCATGTAGTGTCTTTGGACCTTGGGAATGATAG
AAACGATTTGTTATAGCTACTCTATGTATCAGACCCTGACCAAGATCCAACAATCTCATA
GGTTTTGTGCATATGAAACCTTCGACTAACGAGAAGTGGTCTTTTAATGAGAGAGATATC
TAAAATGTTATCTTAAAAGCCCACTCAAATCTCAAGGCATAAGGTAGAAATGCAAATTTG
GAAAGTGGGCTGGGCCTTTTGTGGTAAAGGCCTGTAACCTAGCCCAATATTAGCAAAACC
CTAGACGCGTACATTGACATATATAAACCCGCCTCCTCCTTGTTTAGGGTTTCTACGTGA
GAGAAGACGAAACACAAAAGATGCAGATCTTCGTGAAAACCTTGACCGGCAAGACCATCA
CTCTCGAGGTCGAGAGCAGCGACACCATCGACAATGTCAAGGCCAAGATCCAAGACAAAG
AAGGTATCATTCTTCCTCACTCAATCTGGATTCTTCTCTTTAGCTTTTTGAAATTCAGAT
CTCTTATCATTTACTTGTTTCTCCTTTAAGGAATCCCTCCGGATCAGCAGAGATTGATCT
TCGCCGGAAAGCAGCTCGAAGATGGCCGTACTTTGGCTGACTACAACATCCAGAAAGGTA
CGAAATCATCCGAATCCTTCTGTTGATCATTTCGATGATCTGATTGTATAAACTCTAATG
GATTGTTATCATTTGTAAACAGAATCTACACTTCATCTTGTGTTGAGGCTTAGAGGAGGT
ATTATTGAGCCTTCCTTGATGATGCTTGCTCGTAAGTACAATCAGGATAAGATGATTTGC
CGCAAGTAAGTTTCAATTTCTCCCTAAGATTGTAGTTTTGTTGATTAATAGTTCAAAGTA
CCAAATGTTTATTAGTGTGTTAGGGTTTTAGTTGTTTTAATGGGAATTAACTTAGCTTCT
CAAGCCTTATACAATGCGTGTTGAGGTTATAAATGTTCCCAATATCAAACATTTCCATTC
TCTAAACTTTGTCAGCTGGTCAAATTTCTCATCTTTCCAGATGATTTTCTTGAATGGTAC
ATTTTTGCAAATGGTTTTGAAAATGTGTTGAAGCTTGTATTTTTGATTGCTGAAACATCT
TGTTTGTTGGATAGTTTGTCATCTATGGTCCGATCTGATGTCTCAATGAGATTATTCTAA
TGTAAATTTCGCATCTTTTGGTAGGTGCTATGCTCGTCTTCACCCAAGAGCTGTCAACTG
CAGGAAGAAGAAGTGTGGTCACAGCAACCAGGTTTGTTTTTGTTACTTGTTTCTTTTTGG
TGTTTATCAGCTGAAATGATATCTGAACAAACTTTTTTTATTTGCAGTTGAGGCCTAAGA
AGAAGATCAAGTAGAGAGACTCTTATCAAGAATCCCATCTCTTGCTTGCTTTTTTTTGTT
GTCTTCCCTTTGATAGGGTTTGTTTTTCTTGTTTCAGTGACTTTCTATGTTAAAAGATAA
TGTCAGTAAAAGGATTTGGTTTTCTATTATTCTGAATCGATTACGGAAGATTCTTGCTTA
ATTCCAATCTATACAAGTATCGTGAAATAATGACCGTTTATGTGATTAGGAGACGTGTTT
CATTAATAAAATATAAGATCAATACATTGTTAGTAGTGATAAACTATGTACAAATTGTAT
TGATTGTAAAAGAAACACAATAGGTTCCTTTTTTCTACAATATATTGTGACAGACTCTCT
GTTTTAACGAATGAATTAAATTTGTCAACGAAAAAATTAAAGAATGATGTGATCACTTTG
CACCTTGGTTCATCTTCAGAGGCTTCTGCATGTTCCATGCATTGAGGCTCTCTACGGTCA
CAGGTTGTGAGCCGTTGTTAAAGACAAACAAATGAGCTTTTTCTCCTACTGCTTTTGTCG
GATACACTCTAGATGTTATCACTGTCTTTCCTTTTGCTCCAAAGCTCTCCACAACCGAGT
GATCAATCTGCAAATTCACTCAATTATGTTACCTATTTGCTTCTCTATACAAGAGTAATA
TTCAGTAAAATGATTTAAGTTTGTGACGTACCAAACTCCTTAGAGAGATCTTTCCGTCAA
GGAGACCGACATCCACAAAACCAGCAAACGATGGTTTGTACATCCTCTCCTTGGCGTCAG
TCCCGGTGTCTTTTTTGAGACTCGAACTGTTGATTTATTGTGATTAATGTTAGACACTCT
CAAATTGTAATTAACAAAAATCATATATAAATAATTGAATTAGTGAGTTAGGAAAACATA
CGGCTTGGCGTCAGAGCACATGAGAACCTTAGGCTTGTTGGATGCGGCATCTTTGAAGAC
TCTAAAGAAAACAGGAGTGTATTCTTCTAAGTCAGATGTAGCCAACGTGATCAAACCAAA
AGGACCAACTCCACCATTCACATTCGAACCTTTCAAGTTACATAACTCTAGTGGTTTAGT
TGCGAAGCTTTCGTCAAACTTTTCGGCCTTCTCTAGATTTCCAACGTTGAATGTCACATC
CACATCCACCTGAGCAGGAGTGATTCCTTGGACCTCAAAGCGTTGGCCCATCTCCATTTT
CTGGTTGGTCATTTGGACATTCTTTCCTCTCAATGACTCAATCTCTTCAATAGGCCAAAA
CACGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1142, 1230..1316, 1402..1504, 1884..1950, 2027..2304
1040..1142, 1230..1316, 1402..1504, 1884..1950, 2027..2053
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved