Arabidopsis_thaliana Locus plastid developmental protein DAG
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana plastid developmental protein DAG
Arabidopsis_thaliana
plastid developmental protein DAG
SnoR90, SnoR90-2
1982..2103, 2186..2308
4376
ACGCTGGAATCGAATCCGCTTGCCAACACGTTTCAGAGGTCGCGGCTTACCGTTTGATT
TTCCTCGATTCAAACTCTGTTTTGTACGAGAGCCTCTACGTAGGAGAAGTTGCGAACGCG
AGGATCAGACCAGCGTTACGAATCATGAAACAGAACTTAACATTGATGTCAGCGATTCTT
GCGGATAGAGCTCAATCATTAGCAATGAGGGAGGTTATGAAATCATCATTCGAAGCGTTC
TTGATGGTCCTTCTCGCCGGTGGATACTCCCGAGTGTTCTATAGATCGGATCACAGTATT
ATCGAAGAAGATTTCGAGAACTTGAAAAGGGTCTTTTGTACTTGTGGTGAAGGGTTGATA
CCTGAAGAAGTGGTGGACAGAGAGGCAGAGACAGTGGAAGGAGTGATTCAGCTTATGAGT
CAACCAACAGAACAACTTATGGAAGATTTTAGTATTGTAACGTGTGAGACAAGTGGAATG
GGGATGGTTGGTTCTGGACAGAAGCTACCTATGCCTCCAACTACAGGACGGTGGAACCGG
TCTGATCCAAACACGATCTTGAGGGTACTTTGTCATAGAAACGACCGTGTTGCTAATCAG
TTTTTAAAGAAATCGTTTCAATTGCCTAAACGAAGGTGAACTGGTAAGAAGTAAGAAAGG
AAAAAAGAAAAATTCAACAAAAAAATATGTTGGTGTTGGTGAAGGATGTGAACTTGATTC
GTTGTGTAAATGGGTTAAAAGTATGGTTTTCGAGTTTTTGGGGCTGATTTGTAATCTAAA
AATTGTTGCATTGAGGTTGAAGAGAATTGTTTGTTGTTTTACGAGGAAAATATTCGTTAA
TTCTTTAATTAGATGTGTTCAGAAATAGAAAGTCTTTATTTGTTTAAGAAATTGTAACAA
GTTCTTGCGATGATGAAAAGAATGAGATTTAATGGGCTTTGAGCCCAACTCATGTAAAGC
CTTTATAGTATATAAGAAGATAAAAATTCGAAGATAAAAACCAAAACCCTATCCACTTTA
CTCTAAACCTCCATTACCTTCGTCTTTCTTCCTCAGTCGCCCTACAATGGCTTTGCCTTT
GTCTGGCACGCGCCACCTCACGCGCGCTCTCCTCTCTAATGTCACTCTTATGGCTCCTCC
TCGGATTCCTTCCTCTGTTCACTACGGTGGATCTCGGTTAGGTTGTTCGACCCGGTTCTT
CTCAATTCGATGTGGAGCTAACCGGTCAGGTTCTACTTACTCGCCGCTTAACTCTGGCTC
TAACTTTAGTGATCGGCCTCCGACGGAGATGGCTCCTTTGTTTCCGGGATGCGATTATGA
GCACTGGCTTATTGTTATGGATAAACCTGGCGGGGAAGGCGCGACTAAGCAGCAGATGAT
TGATTGTTACATTCAAACCCTAGCGAAAGTCGTTGGAAGGTATAATCTTCAGATTATATA
TGTTAATTGTCTAGGTTGCTGTTGAAATATAATGAAAAATGTATGAAAAAATCTAGGGCA
GAAAATTCTGTTTACTTTGTGTATTTGACTCTGTATAGTGTTTGTTGTTGGTTTTTGGTT
AGTGAGGAAGAGGCGAAGAAGCGAATCTACAATGTTTCATGTGAGAGGTATTTAGGGTTT
GGTTGTGAGATTGATGAAGAGACATCCACTAAGCTTGAAGGTCTTTTTACTTAGAACTTG
TTTCTTATGTTTACTATGTGTTAACTGATAATAAAGAAGAGTATTCTTAAAGTGTTACTT
TGTTTACAACAGGTTTACCAGGTGTTCTGTTTGTGCTTCCAGATTCCTATGTGGATCCTG
AAAACAAAGATTATGGAGGTAATTGTTCTGCCTACTATTCAAGTTTAACCTATATGTTTG
CTTTATTTCTCCAAATGAAATCTTTGCTAGTGCCATTGTCATTGCAAATTTTGAGTCTTA
GTGTGTGCCTCTCTTGAAACATGAAGGAAATATTTTTATAAGTCCATCTTGGCAAAGCTA
ATGAGTCTTTTGGCTATGATTAGCTTTGAATGCTAATGGACTGACATCGTCTATTTTCTC
TTAACCGATTTGTGCAGATAGTTAATAATATATCTAACTGCAGTCTGGTTTAGATGAAAA
CATATATTGCATGCAACTCTAGAGTGCTTTTCTCTTGGAACGTGAAGACGTGTTATTGAT
TATCAGTCCATCTTGGCGAAGCTAATGAGTCTTTGGGCTATGATTAGCTTTGAATGCTAA
TGGACTGACATCAAATAATTTTTATCTAAGCCGACTTTTGCAGATAGTTAGTGTAATATC
TACCTGCAGACCGGTTTAGATAAAACATACATTGCATCTCCTGAGTGCTTCTTGTTTCAA
TTAGTCCATTTTGGTGAACCTAGTGAATCTATTGGCTCTGTGTGCGCACTAAATTAATGA
CATGACCAGTTGAGAAGATAAAATATATACGCACTGATAGTATCTGTGTGTCACTCTCCC
TAGCCATGTAAAAGATAGTTCAAAGTTCATCTTGGTAAAGTTAATAATTCTTTTTTAGCA
ATGTTTAGTTTAGAATGCTAATAGACTTGTATCAGTTTCTTCACTTGGTGTATGTGTGGA
TTTTGAATAGCAACATGATTAATTTCCTGGTTGAGAAAAAGTATATATGTAACCATAATA
ACCCGGTATAGAGATGATTGGAGGTTTTAGTAAAGAACCATGGACCAGAAGTCCTTCTTG
GCAAAGCTAGTAGCTTTCTGCCATTTCTAGTTTTGAATGTTAATGGACTCACATCCAGAT
TCGCTCTTTCTTGTGCTGTGCTCTTTATATTGAGGAAGCATGGACTCAATTACGAGAGAT
ACACCAGCTTTACATTTCTCAAATTAAATCTCAACTATACAGAAGAACATTTACTGTGAT
CGAATTCTGATTTATTCTTAATCGTTGTCGTTGACTTGCAGCTGAGCTGTTTGTTAATGG
AGAGATAGTCCAACGATCACCAGAGAGGCAGAGGCGGGTTGAGCCACAGCCGCAGAGAGC
CCAAGATAGACCGAGATACAATGACAGAACTCGTTACTCTCGCCGCAGAGAAAACACAAG
ATGAACTGTAACTGAAGATGGTATACATACACCTAAGCTAAGCCAGTATGAGGATGATGA
TGATGATGATGATAATGGTGGTGAGGATGATGTTACTGCCGCCACACGAGGGCTCTGTAT
TCCAGTCCGTTGCAGTTAATGGACCGGGCTTACTTTGGATATTGTTGAAATTCTAAGTTT
TGTTTCTATGTAACAATTTTATTTAATAATGTAAATTGAGGTTTCACTGTTTTAGGAAAT
TACTTTGGGTAGAAGATTAGTTTTCTTTTCAAGAACAATTCATGTGGGAAATGGTAAATT
TATTTTAGTAATCTTTTAGAATGCTGAAGCATGCTAAAAAGAGACGATTACTCTTGTGGT
CAATCTGTGGAAAAGCAAATACAATTTGGGGTTAAAAGGAAACAATGTCAAAATAAAAGG
GCGATCTGATGATATCTCCAATAAATAAGGGGAAAATGAAAAAGTAAACAAGTTGATTTT
AAAATCCAGCGGACAAAATCTGATGTGAGTTTTTTTCTTTTAATCTCTCGTCCCCGAAAA
AAAGTTGACGAAACTCTCTACCGGAGGCGCTAGTTTTCGCCGTCGGCGAGGCAATTTAAC
TTTCCGGAGGTGCGACGCTTCTACTCCGCTTATTTTTTTCTGCTCTTGTTATTTCTCGTC
TCATGTCAAGCTTCTTTATGCCTTCTCTTTGGGTGTAAATAGTTGGATTAGTCGCGAAAA
AATCACGATTGGTTCTTCATTTCGATGTATATTAGGGTTTGTGTGAGCATATGATTGCTG
AGAAGTAGCTAGTAATTGAATGTTTATGTGGTTAGTGGGTAGGAGAATGGGCTGTGGAGA
TATCTCTACTCTGCGCCGTCTAGTTCTTTAGGTCGTGGATTACTTAATGCGATTAGATTC
AATCGGATCGTAGTTCTGATCTATTCGTTCATCTTGAAGTTTCTAGTCAAGTAGTTAGGA
AATGGTGTTGGTTTTTAGAGGCGCAGTCACTGTTTCTTGTACAATCAGTTAAATAACTTG
CTTTTTCTGGTGGTTAGGAGCTTGTTAAATGTGATCGAAGATCTATGATATGATAAAAAA
ATCTGGAATAGTATTGTGTTGGTAGGTTTCTGTTTCTGTGATTTTGGCTCCATGTATCTT
GTAATTTTGAAGTTCCTGGTAATGATTTCTATGTTGGACGAGGGAGTGGAAACTCATGAA
TTCAGCTGTGCATTGCCTTATAATTGTCTTTTGTTCTCATTCTATTAGTTTGTGATTTAT
GTCTGCTGATGATTGTGCTCTCTGCTCATTATCTCAAGGGAATAAAGCAGGATGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1418, 1562..1659, 1752..1817, 2921..3376
1066..1418, 1562..1659, 1752..1817, 2921..3063
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved