Arabidopsis_thaliana Locus Mono:SnoR89
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR89
Arabidopsis_thaliana
Mono:SnoR89
SnoR89
1001..1077
2077
CCCAAAAACTGCAAATCACAGAAGAGCCAAATATAGTCAATATTAACCAGAATTGATCT
TCTCTCTCAACAATCCCAGCTTTATCGCATCTAAATCACTTGACTGGATCCAAACTCAGA
GAAGGGAAAAAAACGAAAATGATAACGAAGCCGATCCAGATCACACTCGAATAAATCGAA
ATTGAACATGTTTAAGCAACGGGAAACGCAGTGAAAGCTAAAGAAGACGATACGAGCTAA
CTTGAGATTCTTATACCTGATGTGATCTCCTTGGGGTCAATTCGATCTGAAAATGGGCTG
CTACCAGATTTAGGTAGGAGTTGATGTCTGCCACAATGTGTAGCAAGCGCGGTAAAAAAG
AGAGATAGAGAGAGAGAGCTTTCGAATGTCAGATAGAAGAAGAGAAATAGGTGTGAGAGA
GGTAAACGGAAACACCTCCGGCGATACAACCTGTTTAATTATTCCTTAAACTTTCATATG
ATCAAATTTATTTTACTTTAAATTATGTTGGGGTCAGAAAACCCCCTAAAAAAAATTCAT
ATACAGTTTATGAAAGATTGATTAGGAGGGTAAATGTCTTTATTGATTCTCTTCTTCTCA
TTTTACATTTTGCCTTGTTTTCTTAAGCATGCTTCACATTCATTAAAGTTAGCCAACAAT
TACAAAGATATTCATTTAGTGGAGGTAACCACTAACTTACAAACTACTAAGACCAAGTGA
TTTATTCTTACAAGCCCAATAAAGGAAATAACAAACTCAGCCCATTAGTCCGTGATCAAC
TAGGGTTTTCTACATGTGGCCGTCACTATATATACACCCATCCCCACTCTTAACCAATAA
TAGCCATCGTAACTGTGGGAATATTCAAGTTAGTCAGTGTCTTTGATTCTTAAGCTCTTT
GAAGTTTTTATCTTTAGGTTTGTGATTGAGTTAGTTAAGGCAGCACGTCACTGATGCGCT
TGAAAAAGTGGTGCTTTCGGTCCTTTTAGCTGCCAAAATCAAGGAAATCTAATTTTCACG
AGCACAATGCTTTCGTTTGCTCTTTCTATGGGCTTATGAACTCAGTAGCTCCTACATTCT
ATAATATTTTTGGTCCTGGAGAAAAAAACACAAAGCTTTATAAAGATGTTGGATCTCTGG
AACAGAATTCAAAACAGTAACAAAAGTAAAAAAGAAATGTTGAAGCACTTGAAAACTCAG
TTGTGCTTCAATTCTAACGTTTCTTGTAAAAAGGACCCATTAGCAATTGTAACATGTCTT
CTGCTGTTGAATCTTTGGTTCCTCCTTGAGATGATGTAGTCATATTGGTTTCATCGAGAA
CTAGCGTAGTTTCAGACACTGACAAGCTTCTTTCACGCTCCTTTCTTGTTCCTTCCTCAT
CACGTTGGACATACTGAGATTCATTGTTAAGTAAATTCACAAATCCTTAATAGTAAAAAC
TGTGGAACTGAAGTATTACATTACCTCATTAGCAAAGCTTAATAAGTCATCAACTGTGAG
ATCATCATCTTCAGGAACAGTCACTGATTGAATCACCTCCGGGCTACGCTTAGCTTCTTC
CCTAATCTTCCTGGGAACTCGTTTAGGTTCATCTGACTTGAGATTTAAGTCTTTCTCTTT
GGTTTTTTGGACTCTTTTTGGTCGTTTTTCAGCCTTTGTTTTGGGAGCTTCGGGTTGTGA
ACCATTGCGTGCAGCTGCTTCACCGGTTGACGCGCCACCGAGCATCCACGGTGGTAGCCG
CCTCATATTCCCGCCGTGATTTTTGCTGAGAAATTTATAGAGAATTGGTCGTAATTGGAA
AATTTCAAAAGTTGGATTTAGAGCAATAAATCATTATATGCGACAGTAATTACCTAAACC
AGAGAGATTTTCGAAGCTCCAGATTTATGAATGACTACCTACTTAATCACAGACAGAATC
CAAGTTACGATCAGTTTGCTGCCAAAATCAGATGAAATTAGGAAACTGCTCTTTTGTTGG
GCCAAATGTTGAGCCCATTTACATCATTATAAGGCCGTAAATCAATTAGGTTAATGGACA
AATCAGTTAGCTTTAGTTCTGGCAAAAATATTATTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved