Arabidopsis_thaliana Locus EIF3G1 (eukaryotic translation initiation factor 3G1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana EIF3G1 (eukaryotic translation initiation factor 3G1)
Arabidopsis_thaliana
EIF3G1 (eukaryotic translation initiation factor 3G1)
SnoR87
1878..1922
4182
TCGTCTTACTTGGCTTAACCGGTACTTATTATCTCTTTATCATATAATCTCTCTCACCT
ATTGGTATGCAACTTCTCTGTGAACTGATGCAAAATATATGATTTTCCTTATGTAGCCAG
TTTTGTCCTGTGGTTTACTTCATGTGGTTTGTTATGGGTCCTCTATGCACTTACCACTGC
CCTTCTCAGTAAGCTATCCTTGCTTTCATCTCTTTCTCTGTTTTTTTGGGTCCAGTTTCC
ATCCTTTTGACTTGTAATTTTTCTCTCTCCCTTAGTGATACTTCTTCATGCAAGCCTGAG
AACTCCAAACCTCAAGGCCCGCTTGAACACATTCCGTGAAGAATTCAGGGCTGTCTGGCG
TAACTACAGCGAACTTTAAAGTCAACATAAAGCATTGATTCGATCTTATTGCAAACCAAC
CCGGGACATCACAGGGGTTTCGAGGAAAGACATGAACTCCAATTCCTTCATCATGTGCAC
AAACAATCGCAGTTATTCTTGTCTTCCAGTAGTAAGCTAGTAAATTATAAGGCCACTGGT
CTGGTTACAGATGCGGCTCTTTGTTCTAGTTAGTTGACTAGAACTACAAGGCAGAATATA
GTGTTGTTTTCTTAAGGTTCTTTGTATACTCTTTCAGTCTATAAAGTGTGTAAGTGATTC
AGTTTTACAAAATCTTTCATTGGCTTTTTCTACGTATAGTTTTTGGATTTGAGATAGAAC
AGTACAGTGCTTTATCAATTGTGTTTTAAAATTTTGGTAGACAAAACGCCAAAACATGTG
GGCTTCGCTTGTGGAATCAGTAGTTCTTTTAAAAGAAGAATCAATCCTGTAAATAAGTGT
TATAACGAAAAGCCCAAAAAACATAAGAGAGTCTAAATTAATTCCTAGAAGAGGGTAAGA
GGCTTAGTGGAGCGGGCCTGGACACAGCTTTTTGTAGATATTAGAATTTTAAAAATTGAA
TTTCTTCACATTAAAATTGCTACTGGACCAAGTAAAATTCTGAAGGAATCAAAACGGTGC
GTTCCGGTTACGGAGCACACACAGATAAGATAGGAAACCCTAAAAGTGCTTCTTCTTCTT
CGTCTTCTTCTTCAGTTTTAGGTTACGATCGAAGCAAAAGCGGCGCATCTGAATCCCAAA
CGAGTGACGATGACGATCGATTCGCAGCAAAAAACGAGCAAATTCAGATGGGGGGAAATG
GACGAAGACGAAGATCTGGATTTCTTGCTCCCTCCCAAGCAGGTGATTGGTCCAGATGAG
AATGGTTTGAAGACGACGATCGAGTACAAATTCAACGATGAAGAAAATAAGGTTAAGATA
ACGACTAGGACACGTGTCCGCAAGCTAGCTTCTGCTCGACTCAACAAACGAGCCATGGAG
AGGAGGAACTGGCCTAAGTTCGGAGACGCAGCCAATGAGGAAGCTGGTAGCCATCTCACT
ATGGTTTCTACCGAAGAGATCCTTCTCGAACGACCCCGAGCTCCTGGTAAATTCTCTCCC
TCTGATGATGATGATGATTCTGGTGATTTTTGTTTGTTGAGATTCGTGGGGTTATTGGTT
CGTATTGAATTTGGAGTTAAAATTATAAATTTGTGCACTTTGATCTAATTGAGTTGGTAA
AATGTTCAGTCTTATGGCTGTGCTAATTGTGTGAATAAGTTTCTAGACTCACCTAGAAAG
ATGTTGTTTGTGATATGTTCTAACTTGGGATTGCTGTCCAATTCATTGTTTGATTCATTA
GTTTTATTGTTTAGTCTAATACTATTGGGTTAAGGTGACCAATTAGCGAATCACATGTTA
GCCGTGAGGCTACTTGTTTGTGTGATTGGTCAGTATGTCACCGATAGCAGTTTATTGTTT
GTAGTCCATTCCTGAGTACGAGCTGAAATGTGCTCTCACTTTTGTGGCTGCTAACTGTAC
ACATAGATGTTGCAGCTTTTCATTGGTCTCCTACTTGATGTTAGGAAGCTTTAGTTTCGA
TTGTTAAAGCTTTTCTCCTGTGACATGTTGTCTCCCATTTGATGTTTGGAAGCTTTAGTT
TCGATTGTTAAAAATTTTGTCCTGTGACATGTTGTCTCCTTTTGTGTTATTACCTTGATG
AAAAAATTAGATTGATGTAGGAGTCACCATGATCTTGTGTTTCAATGAACCAATGTCAAA
TGGTTTGTAAACGGGCAAAGTTTAAGTTCCTTGATAATGTTACTAGGGCTTTCGTGATCA
ATCTATTGATAGGTGAATGACTAGTTGTATAGATAGCCATCAAAGATGATGTTAATCAGT
GGCTTATAGTGCAGACATAGGTTGCTATGTTTGATTCTGTGGCTATGCATTACTGTATCA
TTTTAAAGTTGACTATGAGTTGGCCATTGGTTCACAACTATCTTTCATTCTTTGTGTAAT
TGTGTGTATCTTAACGGTGTGTGATACTTCAGGTACCAAAGCGGATGAATCAAAGGCAAC
AGGAGATGGCTTGTCTCAGCTGGGTAAAGGTGGTGCAGTTCTCATGGTGTGCAGGATATG
CCACAAGAAAGGAGATCACTGGACATCAAAATGTCCATACAAGGATCTAGCTGCACCAAC
CGATGTCTTCATTGACAAGCCACCCACAGGGGAATCATCTACCATGTCTGCTGCACCTGG
AACTGGCAAGGCCGCGTATGTCCCGCCTAGCATGAGAGCAGGTGCAGACAGAAGCGCTGT
GGGTTCAGACATGAGGAGGAGGAACGATGAGAACTCTGTGCGTGTAACCAATCTGTCCGA
GGATACCCGTGAACCTGACTTGATGGAGCTGTTCCACCCGTTTGGAGCTGTCACACGTGT
CTATGTGGCCATTGATCAGAAAACTGGAGTGAGCAGAGGATTTGGTTTCGTCAATTTCGT
GAGCAGAGAAGACGCTCAAAGAGCAATCAACAAATTGAATGGTTATGGTTATGATAACCT
CATCCTCAGGGTTGAATGGGCAACTCCAAGACCAACCTAGAAAGAAATGTCTGATGTTGA
GACCTTAAAACTCTTCTCATTCTCGTCTTTCTTGTTATGGATTTTTGTTTATCGACCAGT
TTGTTTGTTGGTTTGGTTTCTGTATGAATAGATGAGAATTTGTTCAATTTCTCTTTAATA
CATAAGGCATGCTTTTTAAAAAATGGATTTGTGTGATACGTAAGAGTTTTCCAACACTTT
TTTCATTGATGTCTAAAATTATTTGTGATGTTTGTTTAACATTCCCCGTTTCACAAAAAT
ATTGTTTGACTTTTACTTTTTCGTTCTAAGATATCAATCAAAATAATAATCTTTATTAAT
GAAGAATATAACTAATTAACAAATGTTAGTACGTATATTCTTTTAATTGTAATTATAACA
TTTTCGTATCATTATGTAAAAATAAGAAAATTTCCTTTGTTAAATTTAGTCGAAAAAGTA
AAATTTCCATTTATTTTTAACTGCATATATATCAGCTTAAGTAATTTCTTCTTAGTAGAA
GGTCAAATTTTAGAATTTCATTGAAACAATGGAAAAGGTTTCAAAACTCAGTATTATCTT
CCGTGACGAACTACAAAACTTCAACAATGACTATGTCGAAAATATAGATGTCGTCGGCAA
AAAAACATCTAATTCATCATCGGACAATGAAAGCGACCAATTCGCCAGCTTGTTTGGTTC
TTCGTCACCGTCTTCGTTTCAAATGCCTCTTCAGTACCCGAATTACGCAAAGGAACAGTA
CGACATTATGTCGGAGGAAGAACTCGATCGACTTCTCAAACTCTATGGTCTGCCTACAGA
TATCGGTAACTTGTCCTGCAAAAAAGAATTTGCAGTGGGTGCATTCTTGTGGGAGACGGG
GTTAAATTCTTCTCTGGATGAGCATGATTCAGTAAACCCTAATTCGTCCATTGATGATTT
GGAAGAGAGATCTTTGATAGGGTTAGTGACAGTTCTAGTAAAGGATATGGTTCAATTTAT
ATTCCGTGGGTAGCAAGTTAAGGAAGTGAAAGCCTAATTTTGCTTGACCCTAAAGTTTCG
TTTCTTGTTGTTTATATGGATGGATTTCAATTATTATGATTTACTATATCATATTATTTA
ATTTGCTTCGCCGTAAGCTATCGTCTGTTTCCTTTTCTTTTCTTTTTTATCGTCTGTTTT
CTTACAACCGAACAAAAGTTAAAACCAAATTGAATAGGGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1485, 2432..3182
1148..1485, 2432..2979
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved