Arabidopsis_thaliana Locus Mono:SnoR84
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR84
Arabidopsis_thaliana
Mono:SnoR84
SnoR84
1001..1135
2135
CTCTGCTTCATTGGTTTCAAATGAGATACCAAAATGCAGATAAGAGTTATGTGCAAGTC
CTGAGATTCCATTTCAACCATTTTAAGTATCTTGCATTTTGTTTTTAATGATACCTTCAA
ATTCATCGTCGTCTCCACTTAAAGATCCATCCTTTGGCCGAAGTTCAGGAGCTCCATACC
ATTTCCTAAGCTTGGGACCGCCTTAAAACAAGAACACACAAAGACCAAACTCAAGACAGT
TAAAAAGTCTCAATTTTTCTTCTCATAAAAAATTCAAATTCAAATTTCCATGGCAATGAG
AATACCTTCGATATAATCGAGAATCTGATCCACAAAACTGATTTTCTTCTTAGCGAAACA
ACGAACAAGACAACGTTTTCCAGATGTTATCCCAATTCGACATTTATTAGCTTCTGAGTC
CTGATTCGAAGAAGAGAAGAGTAACGAAGGTCCTTGACTGAGGAGACACGAAGGTAGAGA
AGTACCCGCCATGTCTGCAACCACAAAGATAAGGTTTCGTCCTCACCTTGCTTCTACTGT
AAATCTCTCAACAGTTCACAGTAACCCTCTAGATGAGAAAGAGGTTTCTCTAAACCGGGA
TAACTACAAAAATACCTGCTATTGGATCGGATAAGATTGTTATGCAAGGTGTCCAGAGCA
AGTCCTTTCATTTTGCAACCTTATCTCAACGTTCTTCTGCTGATAAAGTTTGGGACTTTC
TTCATAAAAATGTGTGCATGCTAGTTTCTAGTTTTGTTCTCTCTTTTTTTGTGTTATCTT
CTATGAGTCTCTTTATTCATAGATGTTTTCGTTTGATTATATATACCTTAGTCATGTTAT
CTATTTATGATGTAGCTCGTTCTTACTTGAGATTGCACTAGTAGTCTTGCTTAATGACAT
ATAAATCTTGATTTAAACTCCCTCTGGATATTCTTTCATAGAGAAAAAAAATTCTTATGA
TGATTTTATTGTTGTTGTTACTTGTTTTCTCAGCATTGATCCATCTCTGCTCAATCCTTA
CACCAAATTTTGATGGTATAAGAGGATTCAGTGACAATGCTTATATTAAAAATGGAGTTT
ATAGTCTCTCTGAACTATCTATGTCCAAGTTCTTGGGAGTTCGGAAGCACCTTACATCGT
TGACATTTGTTCTAAGTTTTCCTATGACAATTCTTTTCGTTTGCACATTCAGAGATCAGT
TTGAGATCCACTAAAGTTGATGTGGTCTGATACTCACTTCTTATCCCAACCTAATCACCA
TGATAACTTAGTGCTTTTGCTTACCGTCCTAATGGTTTTGTGTTTAGTTTTTTTCTTTTT
CCTTTCAAGTTTCCATTGTTGCAGGAGAAACAGGTCTACTCAGACATGCAACTTCCATTC
ATGATGCAGCAAAATGATCATTGTTGCAAGAGAAGAGAAGTCCACAATGATGTCTCAAGG
ATCAAGGACATTATTTAGCAACAAAGAAATGTTGATTTATGTTTTCAACTATCATGTACT
AAGTAATAATTCAAACTTTGTGAAACATCTAACAATTTGAGAGCAAAAAAATTACAAATT
AACATATGAGTGTCAAATTCACAGACGGCGTGCAATCCTGATCTAGATAGAGCAGACGAC
ACGGCGTGTCTTGCACACGTGACCTAAAACGGAACGTAGTTTACTCTGTTTTGGCATATT
AAGCTATTTACTGACGTGGCAATGCTTCGATATCGGACCAAAGCTGAATAGGTATATACG
GATTCCAAATCACAAAATAAAGTTATTTTTGAGTTAATAAAACGCTTTGGAGTCCGGGAC
CTGTTAATTTTGCTCTAAGCACTGGAAAAAAAAAAAGCCTAAAGGGAGCCAAACATAAAA
GCAGTACCAAAAATTTCCACTTTTCTTTAACCTTTTTTGCTTGTCTAAGAAACTTCTCCT
CTGAAATCATCGTAGATTAATCTGTTTTCTTAGACATGATTAAGTCTCCGACGCTTTGAG
GTAACCGGAAAGTGTAATCAATCGCTTGTTGCTGTATTTGTCACTCTCCGGCGACAAAAC
TTGATTTCCGGTGGTAAGCAATAAAAATTCAACCTTTTTTTAATTCGTTTCTACATTTCA
AGCTTTGATTTTGTTCTTTCTTAATATGTTGTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved