Arabidopsis_thaliana Locus Mono:SnoR83
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR83
Arabidopsis_thaliana
Mono:SnoR83
SnoR83
1001..1130
2130
CGTGCCTAAATACTGGAACTTTCACTGTTTGATCCAATCCCGTAAGTCTAAAATTTTGT
GACTTTTGAGTTTACAGCAAAGACATGAATAAACAAATAATGAATATGTATACATGTTAG
CTTTCTCTAAAGCTTATTGCCATTAAATTGAAGCAAGACACAAAAACTGCAAAACGATAA
GAAGATTAACCAAAACTATTTGGCTAAACCAAATCAATTACTCTTATTTTGAGGGCTTTT
TGTCTGGCCATTGTCTCGTGATAATCACACTCATTTCCGTTCATGTCGTCAAACCTGTTG
AATCCACGAAGTCAAATTAAAATGTACGGAGATGATGAAGAAGAGAAACAAGATAGAAGA
GTTGTAACGCAAGCTGTGGTTGTGGGTGACGATCTTCCTTATTTCGATATTGGCTATCCA
TTCAAGTTTAGGTTGTTGCTTTGTTCTACTATTAATATAGCTCGGCCTTGTGATTATCTA
GTTACGTTTATTGCTGTGTCTTTTGTTCATGCATATTATTTCATTGCTTTATAATGATAC
ATAATATCATACTTTGGTAATTACTTAGGGATGTCTTTTTGAAATTATTAATCAGTCATA
GAACATATATATTCATCCAACTCTAATAGATGGTATATGATATGAATGTTTACCATACCA
CACAACATACGATGGAAAAATGATGAGTTGATGACAGGTCATATATTATTATGTATCTTG
GCATGCCATATGTTTTGGGCTCACAATTATATTTCAATTCTTAACCAAATTGGGCTTCTT
AAACATTCACCAGGCCCATTGACATAATCATTTCGATTCAGTTTTCAGAAGGGTTTTTGA
CTCTAGGATCCCTTTCTCTAAAGCTCATTGCCATTAACGTTAAACAAAAACACTAGAAAT
CAACAAAAACTATTTACCTAAACCAAAACAATCACAGTTTATACAGAGTACAAAATAGTG
TCATAAAACCCAAGTAAATTAGAGAATTGATTAGGGAATATATATGTAAGCAGAGTTACT
AATAAAACACCTTCTGGGATAAAAGAGAAGAAGGTATTATCAGCGAAACTCGCAGCTTTA
GTTTAGGCCTCACATGAATCAGATAAGTACTTCATCAAACTTAGCTGGGATTAAGAAAGG
CCCTTCCATCTCTCTAATTTCTCTTCTCTATTTGAAAACAACTTTTAAACTATGAATCAA
ACTGCGAGCCTTAAACATTCTCTAAGCATATGAGAAAACAAAGACGAAGAACCCTAATTC
TAAGATCCAACATAAGAAAATAAACAAAAACCGAAGAGAAAAATATATCGCCGAATATAT
ATAACAAATCTCCGATCATTAGTCAATCGCCGCTTGAGCTTGGATTTGAGGCAAAGACAA
ATATATAGGATTTGCTTTTTTCATCATTAGGGTTTCCAGTTTTCAATGTTTTGGGCTTAT
ATTATCGGGCCTTTAGGTTTAATTGGCCCATTAGTTGAAACTATACACGGATGGTTTTCT
TACTTTCTAATTGCTACAAACAACAGACTAATCTGTTTTTACATATTTAATGGTTCAGAT
GTCATCAAAGATTATCTGTCCAAATATTTATATTATAAGATACATTTTAATATTTAATTA
TGATTTAGTAGAGCGGCCGATCCGTTTTGATATGTTTAGAACTAAAAATTGAAATATACT
AAAATCAAAATTGGCAAACATTTGAACGAGTCTCATTTATATGTCCTCTGACCATATTAT
TTAATGGGCCTATCACATTTCCCGAGCCCAGATAACGTCTTTTCAGTTCTCCTATCCTTT
TGGTCAGCTTGTGCATGGTTGTTACTTGTTAATGATGGCCAACATGTTTTTGATCGTGCA
TTACACTTAGGTATGAGAATCTCAAACATACATGATTATCATCAATTACTCACTTTTAAG
ATAACGTTTCTTTATTTCATATTCAAATTTTTAATACCCCAAACATTTTCTTATAAAGCC
CCATTTGGTGAAATCGTTTTCCTCATCACAATTTAAATACAAAGAACACAACAAACGAAC
TAGCTTAAGGCAATATACAAGCCAAGCGCTCAGCAATGGCGATCACACGCTCCTCCTTGG
CCATTTGCCTCATCCTCTCTTTGGTTACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved