Arabidopsis_thaliana Locus Mono:SnoR82
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR82
Arabidopsis_thaliana
Mono:SnoR82
SnoR82
1001..1140
2140
TAAGCCAAAGTTTGAGACAAACAACAGAGCCAAATTCAACTAAACATAAGTGTAAGACT
TTTCAAGCCCAACTATGAAGCCCAAGTAGGAAACCGCATCAGGAAGAAAGAAGAATCATT
GAAACAGAACCTAAAACACGTGTCATGAAAAGGTTAGGTGCTGAAGACACGTGAGAAGAA
GAAGATCGGAGAATCACTGGTCGCCGCCGAAGAAGATTGTCGACTCCATTGAAACCCAGA
ACGCCGCGATATGCATGTTGAATCCGGTGATAGCAATTGTCAATTCCAAAGCTCTAAAAA
CAAATCTTCAACTTCATGGAAATTCAACTTCAAAATCTTCCCAATTAAACGTCAACGGTT
CACGAACTCAAGCATCATATTCATCAATCTTATGTTGGAGAGAATTGTGTTTAGGCAAAG
ACGAATCACCTAAAACCACAACACTAACATAGATCGCATAATTTATTCAACAGAAAAAAC
AAAAAGCGGCAACAGATAGCCGAAACAAAGCCGGACCTCGCCGGAGACAAAGCTGAACCA
TACCAGAGACAAAACTAGTAAACAAACCGGATGGAGAAACAAAGATCGTGTTCCTCTCTC
TGAATAATTGAAGAGAGAGAAGAGAGAGAAATTGATCTTTTCCCCTTCCAACCGAATCAA
TCTAATATCCGGTTTATTGACATTAGTTCCAAAATCAAAATCAAACCTAGTAAGAAATCC
GAAATGCCGGTCAGTTGTGGGCTTTCAGTTTGGGCTGGGCTAATAAAATTAATGAGCCCA
TAAGCTTTTTCAAAGAGAAGAAAGGAGAAGAGAGAAACCCTAATCTCTATTCTCTCCCAA
TCTTATATATAATCTCTCTTCTTTCTCTTCTTCTACAACGCCTTTCTCTCATGTCTCTAA
ATTAGCTACTCTTTCAAAATTTTGCAGCTTAAACGAATCGTAAAGTACTCCTTTGTTGTT
TTTTTGGGTCTGTAGTTTTTTTTTTTTTAAAGCAAGTCTCAGCTTCTTTGATTGGGTCAA
GATATTCACGATCCAATCAATTTTATGAAAATCATAACTTGCGAAATAGAAATCGGCAGT
ATCACTCGCCTGGATCTGATTATAATCATGATTATCCAGGCCCTTAATCTACTGGCACAA
TCTTTTGAAATTAGATTTTGTTGTTGTTGTTTTGGGCAAACGCACTCTGTCCCAAGACCA
TTAATTCCATGTTTTGGTGCAATTTCTTCGTTTGCTAAATTGATCTGTACTCCAATTTTA
ATCATGTCCTCGGGATTATTCTCTGTGATCCCTATATGGGCACATGATTGGTTTACTATA
CTTTGATTCTTTCGATACCAAATAGTTTTACATAAATCGTTTTTTAGGAGTTAGTTTGTT
ATTTGAATTGATATGTTTATATCTTTGCAGAAGAATAAATCTTATCTGGTGTACGATTTA
TGTGATACAGTCACCAAGGACGGTAATTGTTTTCGGATTTAGGTTTAATGAACGGCTTAG
GATTAAACTTGAAACATCTAATGAATCTTTGAATAGATTATGTGAGAACATGCCTTGAAG
AACATTTGATTTTGACCTTTCGAACGAATAACTTATATATCCAAAAAAATTACTCAATTC
GTATATCCCGTAATTTCCCAATCTGAAGATTATAACCAAAATCAAGAGGCACGTATCTAA
GACTAAATGTGTCATAACTCACTGAAATTGTTGTTGAAGAAGAACAGAAGATACTGATGA
TGATGGATAAAAAAACAAAAAGAAGATACTAATGATGGAAGTCCTTCAGTTGATGAACAT
AATACTGAATTATTGATGATGAAAGTCCTTCAATTAGACGTTTGGCTTTCTATCATTTAG
GCCCATATATTCCGGGTATGAAGCCGGATCCTATAGCCCGTTGGTATTTGAACGGGTCAA
GTACGGATCAGATACTATGACATATTGCCACGGGTTTGGCGCTTTTTAGAAAGATAAGAG
ATGCATTAGTCGGGACTCGGGCGGTATCTTCGGCGCTATAATTTTAATTGGGCTTTTAAT
GGGCCTGAATCTTTTGGGCATATTATCCATTTATGTTTGGAAGGTGCATCAACCTTTTTT
GAAAGTATACATGCAGTATAGTATTCATCGCATTCTTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved