Arabidopsis_thaliana Locus EIF4A1 EIF4A1 (eukaryotic translation initiation factor 4A-1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana EIF4A1 EIF4A1 (eukaryotic translation initiation factor 4A-1)
Arabidopsis_thaliana
EIF4A1 EIF4A1 (eukaryotic translation initiation factor 4A-1)
SnoR81-2
1650..1737
4707
ATGATGATGAAGATAGTTTTGTGTTTAGGTTTTTCAGAAATGGCAAAATGCTGCCTTAC
ATGTACCAGATTGTATCGTACCAACACCAATTCTACCATAACCGATATAAAAGTATTTAA
ACCGACTAATTAAGCTTCACAAATTTCGGTTTGTACTTTATTATATTGGGCCCTATTATT
ATTCTCTGAGCTTTTGCGTCTCACCAAAAGACAGAGATCATCAGGTGCGTTAGTGATTAC
GTAGGCATCTAATGAACGGCAGGGATTAGTCAAACTTATTAATGGGCCTAATCTTTGGCC
CATCGTTTTCCCTCGATTCCTGTCACACAAAAAACTCCTAGCTCTTCCTCTACCTACACA
AGCTAAATACATATTTTTTGCTTATCCTAAGCATCATGATTATGTTTTGCCCTCTCCAGC
TTTTTCTTCAATGGCAACAGATTCTAAGAAAGTCTCTTGAGGCTAAAATCAAAGCATTTT
TTGTTGAAGATAGATAGCAACTTGCTGCTTCTTCATACTAGCTAGTTACCTTCTTCTTAC
TCAATGTGTTTTGCTTCGTTTCAAGGATTCTTCATATCACTTGTGGAACAATTACATGAT
TAAACATTCAACATAGAGAGATAGATGTGTTAATAAGTAAAGACATTTTCAGATAAAACG
TTCTTATCAGTCACTTTATTCTTCTAATATCCTCGTTGTAATCGGGAAAATGCTTTGTAA
CGTCAAAAAGCAATAAAAGTTGCAGGAGAAAGAAAGCTTTGGAAAAGAAAATAAAATAAA
TGAAGAATATTTTCTTTGCTAGTCACAAAATAAATGAAGAATTTATGTTCCTAATTTCCC
ACTAGATATTTGTTTATTTATTTTTGCCAAAATCAAGTTAAGACAATGAGCTAAGTGTTG
GAAAACCTTGTCCGAGCCAAAAGAGTAAAAAGAAAGGGAATAAAGGGGTAAAACCGGAAA
TCCGAAAAAGAAAAGGAGAAGATTTCCAAAGGAGAAAACCCTAAAGACGGAGTATATAAA
CAAGGTAACGCGTTTTCTCTCAGCCTCTTTCGGATATTCCACCAGTCTCTCGCAATCTTC
GCTCTTCTCTTTGCTCTCTCTCTCTCAACGCGGTTCAGATCCGAGTTTGGGAGATTCAAG
CTCCCTGAAAAAAGCCCTTTACTCTCGCTTACCAACTTTGCTCCAGGTTCGCATCCTATC
GGATTGTCTATCTATTATCTCGATGTAACTTTTACGATTCATGATTGTTTCTTTACTTTT
GGATTGTTCTGATTTGTTTTTTTGTGTTTTCCGATAGATTTGGTTTCAACTTTGTTGAGT
TGATTTGGAAGTTTTGATTTTTCGTTACTTCAAGATCGTTTTTTTTGCTGTGGAAGTGCT
TTCGTTTTTGTTCTCTTTATTAGATTCTGAGCTGCTGATGATGACGATTATTAAATTTAG
GATCTACACATCTGTAGATTTGTTGATGGGTTTGTAGATTTTGTTACGGCTAGGTTAGTC
TCTCAATAGAATGAAATGAATCGTCTTCAAAGCTCAGATGTTCTTGTCTTAACACTCACT
TGGTTTTGTCTGATTGAATGTTTTTTTTTGTAATTTGGAGAAATAGGTTGAGTGGTGTCT
ATGTTTAATAGATAACCATATGTGCCTTTATACATTTTCTCCGCACATCATCTGAGGCAG
ATATTAATGCTTGTTTTCCTCTCTTTATGGACTTCGAGTTTGGCTTTCTTGTCACATTTC
CTCCTTTGCAATCATATTATTAACGATATCAAAATAGGTGTTGTCTCTCTTCCTTTTGAT
ATGAAATCTGATTGTTTTTGTTCTTTTTATGTAGCATGGCAGGATCTGCACCAGAAGGCA
CACAGTTTGATGCACGTCAGTTTGACCAGAAACTCAATGAAGTGTGAGTCTTTTTACTTC
TGTTTTTTCATTCTTGAGTGTGTTCTCTCCGCATGCTCTAGCTGCTAATTGTACTGTATT
GATACAGACTTGAGGGACAAGATGAGTTCTTCACATCCTATGATGATGTTCATGAGAGCT
TTGATGCCATGGGTCTTCAAGAGAACCTTCTCAGGGGTATTTATGCTTATGGTATGTGTG
TAGGAACTTGAAAAAGCTATCTTTTGTGATTTATGTCTTAGATTAGAACATTATCTCATG
CGTGCTTCTGTTTTTTCTTAGGTTTTGAGAAGCCTTCTGCTATTCAGCAAAGAGGAATCG
TCCCCTTCTGTAAGGGTCTTGATGTGATTCAACAGGCTCAGTCTGGTACTGGGAAAACAG
CAACTTTCTGCTCTGGTGTCTTGCAGCAGCTGGACTTCTCCCTTATCCAGTGTCAGGCTT
TGGTTCTAGCTCCAACTAGAGAGCTTGCTCAGCAAATTGAGAAGGTCATGAGGGCCCTTG
GTGATTACCTTGGTGTCAAGGTTCACGCCTGTGTTGGTGGAACCAGTGTCCGTGAGGATC
AGCGCATCCTCCAAGCTGGTGTCCATGTTGTTGTTGGAACTCCAGGGCGTGTCTTTGACA
TGTTGAAGAGGCAGTCTCTTCGTGCTGACAACATCAAGATGTTTGTTCTCGATGAAGCTG
ATGAAATGCTCTCCCGTGGTTTCAAGGACCAGGTATGCAAATATTTCTCAGTGTTTCAAT
TCCATTCTCGTTATAGTTTAACTTGAATCTCACTGGTTTCTGGGTTTTTTCAGATCTATG
ACATATTCCAGCTTCTTCCACCAAAGATCCAAGTTGGTGTGTTCTCCGCAACAATGCCAC
CAGAAGCTCTTGAGATCACAAGGAAGTTCATGAGCAAGCCAGTGAGAATCTTGGTGAAGC
GTGATGAGCTTACCCTTGAAGGTATCAAGCAGTTCTACGTCAACGTTGAGAAAGAAGAGT
GGAAGCTCGAGACACTCTGTGATCTCTACGAGACTCTTGCCATCACTCAGAGTGTCATCT
TCGTGAACACCAGGCGTAAGGTTGATTGGCTCACAGACAAAATGAGAAGCCGTGACCACA
CAGTCTCTGCAACTCACGGAGACATGGACCAGAACACCAGGGACATCATCATGAGAGAGT
TCAGGTCTGGTTCCTCCCGTGTTCTCATCACCACTGACCTCTTAGCTCGTGGTATTGATG
TCCAACAAGTCTCCCTGGTTATCAACTTCGATCTCCCAACTCAGCCAGAGAACTACCTTC
ACCGTATCGGAAGAAGTGGAAGGTTCGGGAGAAAGGGTGTTGCGATCAATTTCGTGACCC
GTGATGATGAGAGGATGCTGTTTGATATTCAGAAATTCTACAATGTGGTTGTCGAAGAGC
TGCCTTCGAACGTGGCCGATCTGCTGTGAAGGGAGAAAAGAAGTCGGTTCTGTTGCTGTG
TTTGCTCTGCCGTACTAGTATCACCGGAGAAGAAAGGTTTTCTTGTTTTGCAAGGCACTC
TTTGATCTGATTTTGACCCGTCGTCTATCAGCGATTTACATTTCTTAAATTTTCTTAGTT
GTTGTTCTCTCCTCTCTCTCCCAGCTACGAACATATCTCTCTCTTCTTGACCATTTTTAA
GTTTAAGTCATATGGAGTATTTATTTCTTCACTATTTTAATATTCGGCTTTGTTGTTTGT
CTTTGATTTTTGTATCAATCAAATCTTTTCATCAAAGTTTGGTTTTAAGCTTTTTCAAAT
CTATATCTCAGCATTAAACTTATTTTATATGTTTATGTCAAACTGGTTAAAATGCTTGGC
TCACAAATTAATTGAATAGTCGGGGTTACTTTTTTTCCATTGCATCAATCAAGGATGAAG
CATTGGCACACTCTCTCAGGCGCTGCTTTAACGACAAATCTACTGATCAAAAGTCTGTTT
GGACACAGCGACGAACTCGCTTTATCTTTCGTTTTTCATGCATCTTCTTTATATTTCTAG
CCTTATGGAAAATAAATATTATATCTAATAGTTTTGATGTACTATTTCCTTTTTTTCTCA
AAAGAAGTATATTCAAAATTTTATGGATGTGGATTCAATGATTCCGAGTCAAGCCTACCA
CCGACAAGGGTTTTTCACTTTTATAATATCAAAGTGAAATTATTGGTCTGAACTTCTGCA
AAGTTTCTTCACGAAACTATGAAAGAAATTTTATTTCCTGTGAGAAATTACAGGTTTGGA
CAAATCCACGTGCCTATTTTGAAATAGTTGGGAAATCATCACATCCACACAAACCTAACC
ATCATTATAAATCATAAGAAAAGAAAAACACATGAAAAGTCTAGTGATTCATACCAATTT
TACGTATTCATTTTCTTTCTATTTCTAAGTTGAATAACTTAATTCGTTTGAAGAAAAAAA
GAGGGAAAAAAAACACAAGTAGGTCCTTGACCAACTCCACATGACAATTGTAAATTGATT
TCTAAAAAAGATACCTTTAATTATTTGGAAAATAAACATATTGTTTTATTAAAATTTCCT
TTTATAACTTTTAAAAAGACAATCAAAATCTATTAAAAACAGAGTCGACGACGACTCTTC
TTCGTTCAGACCAAAACTCTCAAACTCAGCCATGGCGAATTATTACGAACCGCCAGCTTC
TGGAAACCGTCGAGACGCAGTGAAAGGTTACAACAGCGGGAGCTTCGACGATTCAGCCGG
CGATCAGAGTCAAACGAACGATTACCAGTTAAAGATAAAGAAAAGCAAAAGCGTTCCAAA
CGCGGATCGTGCGGCGTCAAGAAGCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1185, 1834..1902, 1987..2090, 2181..2611, 2693..3707
1001..1185, 1834..1902, 1987..2090, 2181..2611, 2693..3707
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved