Arabidopsis_thaliana Locus EIF4A-2 EIF4A-2 (eukaryotic translation initiation factor 4A-2)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana EIF4A-2 EIF4A-2 (eukaryotic translation initiation factor 4A-2)
Arabidopsis_thaliana
EIF4A-2 EIF4A-2 (eukaryotic translation initiation factor 4A-2)
SnoR81
1520..1707
4575
tttaggatgtttttgagtgagtgcctgataattctcgtttctcaaggcaaactggaaaa
ggtatatttttcttaattgctcagctatttattgatgcatcatcatctatctataacaag
atcatttgtaattcttatgattgattaaaatcagaaaatctcccaaattgcaggtattgg
atcgctacaagatatcagaattagaaaacaaagtgttggaagtagcaccagaagttgtag
caatgaaactagcagagtcagataacaaaaggttgatagcagcagaggcagtcgaagaag
aagaacgaatgcacaagttagtagaagaaagccacacgatgcttcaattatgcttagaga
tccaccaacaatgtaatctcaacaaaactcacatggtacatcaatccatcatcatcacca
tgatcatcactgtcttttgctttgtttcttgcaggtgctcttggccaagaggttgttcta
ctgtaaaagaaaaccaagtatctatctagtttgcttcaatctatattttacttaactaac
cacttgagttttgtttttgtagttcttaaacacaggtttatatggttgtaatggtgaact
aatgttcactgttttgttcataaaaagatagctttttttttttttgctaaaaaacaatga
cgtgtctatggagtcttgtgaatgctttgctacgtcataaagcatcaaaaggtgctggaa
agaataagcttttccaaaagaaaatttggtctttttttctaattaaaaagtttggtattg
gcgtatggaagtacaacactactactcatatttccacttgaaaacaacattttgtgattg
tgatttgatattttctggtgtgtgttagtatgcaattgcgattcattattcatagtctct
tttgacattggtgtaaaataacttgattggtaacaatattttccctactagtttaggaaa
agtataaagaggtgagaaaaatctcaaatcgaaaaggaagaGGAAAGTGGGGGTAAAGTT
GGAAATATAAAAATTTTGGAAAAGTAGAACAATTAGAAAGAGGAAAACCCTAAAAAAAAA
AAGAGGGGGACTATATAACTGGCTAACACGTATTGGGTTGAGTCTCTCTCTACCTCAATT
TATATTATTTGCTTCAATCTTCTCTTTATCGCTCCACCAGATCCAAGTTCGCGAGATTTC
AAGCTCTCTAACAAAGTTCTTCACTTTTACTCTCAAAGCTTTCATCTTTCATTCAACTAC
TTAAGCTCCAAGgttcggaaatattttttttacttttctctgcgatttgttccttttctt
atgaacgattggatctcgagtctgatttactctctttgcgatggaatttgttctgggtcg
ttttcaaaattgacgcttgttaatctataattcgtcatcggattcaattagtccgtgaaa
cccttcaattcgtttatctcaaatcgatttgggttaggttttgatttcgacacttatgtt
aaaatcatccaaagcttttatcttcgattttggacaactttgtgtatattatatgctttc
atggagagatagatgtttttgaatggtatctgttatgataattggatgaaccatatttcc
tatatctctcctgacatcgaataattcagatattaatgcttgtgttcctctctatatgga
acttcaagtttggctattctgttacattcttacttttgcacaactctctctggctataag
atttaagaatcatctctagctatctgggttctaaactattgtttcttttgtgtattgttg
tagTATGGCAGGATCCGCACCGGAAGGAACACAATTTGATACGCGTCAGTTTGACCAGAG
GCTGAATGAAGTgtaagtcctaagatctttagtttcattactcgtttttgatgagatttt
ttttgtatttgctaatcttattgtttgtttgggtgcagTCTCGATGGACAGGATGAGTTC
TTCACCTCATATGATGAGGTCCATGAGAGCTTTGATGCCATGGGTTTGCAAGAGAATCTT
CTTAGGGGTATCTATGCTTACGgtaagtgaagaaggtttaaagaaacaaccttttgtttg
ttatgttgggattcctattaactttatcgtatgtgctctttcctgtgattgattggttga
tttttttctagGTTTCGAAAAGCCTTCTGCTATTCAGCAAAGAGGAATTGTACCCTTTTG
CAAGGGTCTTGATGTGATCCAGCAGGCACAGTCTGGTACTGGAAAAACCGCCACTTTCTG
CTCTGGTGTCTTGCAGCAGCTTGACTATGCCCTTCTCCAGTGCCAGGCTCTCGTTTTGGC
TCCCACCAGAGAGCTTGCTCAGCAGATTGAGAAGGTCATGCGTGCCCTTGGTGACTACCA
AGGTGTCAAGGTTCATGCCTGTGTTGGTGGAACCAGTGTCCGTGAGGATCAGCGCATTCT
CCAGGCTGGTGTTCATGTTGTCGTTGGAACTCCCGGTCGTGTTTTTGACATGCTTAGAAG
ACAATCTCTCCGCCCTGACTGCATCAAGATGTTTGTCCTTGATGAAGCTGATGAAATGCT
CTCCCGTGGTTTCAAGGATCAGgtttgttatcttcttcaaagtttgaatctaccctctgt
ggttatctctgatattgacttggttttgtgttgttttctggtgaatttgcagATCTATGA
CATATTCCAGCTTCTCCCACCAAAGATTCAGGTTGGAGTGTTCTCTGCGACAATGCCTCC
GGAAGCTTTGGAGATCACAAGAAAATTCATGAGCAAACCAGTGAGAATCTTGGTGAAACG
TGATGAGCTCACACTTGAAGGTATCAAGCAATTCTACGTGAACGTGGAGAAAGAAGACTG
GAAGCTTGAGACTCTCTGCGATCTCTACGAGACTCTAGCCATCACTCAGAGTGTCATCTT
TGTCAACACTCGTCGCAAGGTCGACTGGCTCACAGACAAAATGAGAAGCCGTGACCACAC
AGTCTCAGCAACTCATGGAGACATGGACCAAAACACCAGAGACATCATCATGAGAGAGTT
CAGGTCTGGCTCGTCTCGTGTTCTAATCACAACCGATCTCTTGGCTCGTGGTATCGATGT
GCAGCAAGTCTCTCTAGTCATAAACTTTGACCTCCCAACTCAGCCAGAGAATTACCTTCA
CCGTATCGGAAGAAGTGGAAGGTTCGGGAGAAAGGGTGTGGCGATTAACTTTGTGACTCT
TGATGATCAGAGAATGCTGTTTGATATTCAGAAATTCTACAATGTGGTTGTTGAGGAGCT
TCCCTCAAACGTGGCTGATTTGCTGTGAAGAAGAAGAAGAAGAAGAAGAAGAAAGGTTGC
TTGTTTCGCAAATTTCTTATTTGATTTTTGACCCGTCTCTCTCTCTCTGAATCATCGATA
CATCTTTTTCATTCTCTAGTATTCTTCATCAACTCTATCGAACATATATATGTCTCTTCT
GACCATATTTCTTTTTTATCAAATGCAATATTTATTTCTTCTCTTGTATGATCCAAAAAT
CTTTCGTAATTACAAGTCTATTCACAGCAATTCTATacctgtttttactgtttcggatgt
cacttacatagaaatctttcactggggtcatgtgcgattatataattcctaacattaaga
agtggtcaagagctttagttcatatctttgaaaacagtttctttttcaatttcggaagta
agagtacttaagcttttccatgctaatctttttttgtgaatccatttgtaaaaaggaaaa
aatgtcaactatttgtcaaacttgtctaatcagcaacatatcttttttcttcttttcatt
agtactagtgtacatacacacacacagacaaacacaaaatacaacattcccctctttctt
ctaccattgtctaattgtataaaccataagattagtaagaaaataaaataagagtctctc
tttctttcatctaacttgaatccaactttctccatctgatgatttcccgaagaaaaaatc
acagaaatatatatgaagtggttaaacaaaacatacttggtcttaatcatcaagtctatt
gtgagtttgaagaaggtgtatcattagacgatgttccactcataacacttaacaccgaat
gcttcctttgaagcctgcctcttagctgcctgatcttagcatcaactcgagccgtgaacc
caatctttgtcttctctctcgcctttgacttctctcgtttccacattcgctcatcctcta
catcgatcctgaaatgtttgatctcttgtataatgtgatggtcaagagggttcactgatc
tttggtatgaaatgtggaacaagtaaggtagcgttgtggcggcaatgaccagaagtgaag
taagccagaagatgggtgcaggggcaagaatctcgacgagcatgtgaaagatgttaccag
agagttttactggtaacataccgtaaagagcgaggaagacgtaccaagctcctatgcttc
cccaaatcattacgtgttggatccaagtgaagtgactcatggttagagctatttgaacat
ttactgcccatatgat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1271, 1803..1871, 1958..2061, 2171..2601, 2692..3575
1804..1871, 1958..2061, 2171..2601, 2692..3327
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved