Arabidopsis_thaliana Locus AT-IE (Arabidopsis thaliana bifunctional HisI-HisE protein) (AT-IE)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana AT-IE (Arabidopsis thaliana bifunctional HisI-HisE protein) (AT-IE)
Arabidopsis_thaliana
AT-IE (Arabidopsis thaliana bifunctional HisI-HisE protein) (AT-IE)
1
SnoR79-3, SnoR79-2, SnoR79
1376..1532, 1665..1818, 2035..2188
4500
CTTCATCAACCAGAGGTGTTTCCTCTATACGAAACAAATGAAAAGAGAACACAATATGT
AAATGTGAACTGTTATTAGATCAGGGAAGTGAAAGCATTACAGATGCACAAGTCCAAGAA
ACAAGAAACAGTCAAGCAATTTACCTGCTGAATCATCTTCGTTTTCGTCCTCTTCAGGAT
CAACCTGCTTTTGCCAAACTGGATCTTCGTCGACAACTAAAACACCTCTTGGTTCAGGTT
TAGATGGCTTCTTCTGCTTCTTCTTCTTCTTCTTCTTCTCTACAACATCACTACTTTCAT
ACTTCTTCAAGTAATCTTTTAAAGATTGGTTTCCTGCCATCTTTGAGAATTTGGAGCCTA
AATACCAATGATAAACTTGAAAAATTCAGTCAAACATAACATCTAGACGAAGATATATTC
AATTCAGGAACCAGAGGTTCAAGCAGGAATTAATGGCAATGCCACCGTTCATCATCTTAA
GAGACCGAATTATAGATATAGCTTTCAAAACCAAATCTGGAATCAACAATTAGTTGCTAA
ACTCAAATTAGCATCAATCAAGCCCTACGAAAATGAGACTGAATCGAGAATAACAAAAGA
ATGCTTAGTCTTATATCGTCATCAAATCCACAAATTTGCATCTACTCAAAAGCGATTCCA
GAAAACTAGAAAGCTAAACGAAGACAAGCATACATTCATAGAATCGTAAAATTACTAACC
TGATCGGAAAATTAACGCCGGAGATGACCGGGAAAATATCAGTAACCCAACGCGAATAGT
TGAAAATGATAACTCGGAGAGCTAGCTCTTCTAGGGTTTTTGGATCTCCTGGAGACGAAG
AATAGAGAAAAACTTAAGTTATGGCGGAATTTGAAATTTCAAGCAATTAATAGGGATTGC
TTTTGTAATTCCTAATATTAAGACATAAATAGGGGCATTTTAGTATTTGCACACATTGCT
GAGTCGGTCTTTAAAAAGCCCTTCACTATCACATTGACTTCAGAACAATTAGGGTTAATC
TCTTCCGTTGCTTTTTTTTTTCAATCCGCCGCCACTTTTCGTTTCTCGTAGCGTTAAAAT
GGCGGTATCGTACAATGCATTAGCTCAGTCTTTAGCGAGAAGTAGCTGCTTCATCCCCAA
ACCTTATTCCTTTAGAGATACTAAGCTGAGAAGCAGATCCAATGTCGTATTCGCGTGCAA
TGATAATAAGAACATTGCTCTTCAAGCTAAGGTAAACATCTTCTGTGTAATCTTAACTTA
TAGATAGAATGTTCTGCAATGGAATCGTGTTAAGTTTAATTGTTATCTAAGAACGATTAG
AATTTAGATTGAATATTGAACCAGACATTGTCAGGTGCTTACTCTTTGACATATGAGTAA
TTACTGTTACATGTCGGGTAGAGAAAAAAGAGAGAAGGAAAAGCTTTTTAACCTGAGCTT
CATTTTTAGAGTTTGGATTTCTTTTTTAAGATGCTCATCGTTTGCTTGGTCATCTGCATT
TGGTGATGCCTGAGCTACATCTGTTCATCACATTTTATTAAAGCATTTAAGTATATTGTT
ATGCCAAAAGTAATTTAGTTCTATGAACATTGTCTGGAGTAAATTGTATATGTAAAGTTT
GGATTTTTGCCAGAGATGGTCAGGTTCCTACCCTTTGACATGTGGGTTTGGACTGTTACA
TCTCTGGTATAGAAAAGAGAGAGAAGGAAAGGCTTTTTGATGGTTTCCATCTTTAGGTTT
GGATGTCTCTTTCAAGGTGCTCATCGTTTGCTTGGTCATCTTTGTTACGTGATGACTTGG
CTCCATTTGTTCATCACAGTTGATATCTTTTCAAGGAAATATGTATTGTCTTGCGCTCTC
AGAGTTGGATTAATTCATCACTGAATTACTGTGATGCCTTCCGAAGTAACTTATGTTTTA
ATTTAGAGAAAAGGAGGTTCATGTAAGATGTGTCATTTGTTAATCTATTTTAGTTACGTC
ATGTACAATTGAGATTTGGCCAGAGATGGTCAGGTTCCTACTCTTTGACAAATGAGTTTG
AACTGTTACATCTCTGGTAAAGAAAAAAGAGAGAAGGAAAGGCTTTTTGATGGTTTCCAT
CTTTTGGTCTGGAGTTTTCTCTAAAGGTGTACATCGTTTGCTTGGTCATCTGAATCTGTG
ATGGCATGGGCTACATCTGTCCTCCACAACCTGAATAATCTTCATTGAGACATTTCTCTT
TTGGCTTTAATATCTAGTCCGATAATGCATTTACTGTTTATACTATTAGAGAGGGGCTTG
TTTGATTGAAATGACAATGTTTTTTTCTGTGTTGGTAGTGTTGCCATTGTGCCTTTTATT
ACTGTCTCAATAAGCAATGTATATGCGGCTGTTGTGTTCCCTGGTAGCTAATCATGGTTT
CTGTTGTTTTCTTGTGTTAGGTAGATAACTTGTTGGACCGCATTAAATGGGATGACAAAG
GATTAGCTGTGGCAATAGCACAAAACGTTGATACGGGAGCAGTATTGATGCAAGGCTTTG
TTAATAGGGAGGCCCTCTCCACAACCATCAGTTCTCGGAAAGCTACATTCTTTAGTCGAT
CAAGATCTACCTTATGGACTAAGGGAGAGACATCCAATAACTTCATCAATATTCTTGATG
TGTATGTTGATTGTGATCGTGATTCGGTATGTTTGCGTGGACCACAGATATGAATCAATG
CAGTGTTATTCTTCATAAACTCATTGGTCTCTATTTTCTCAGATTATTTACCTTGGAACA
CCTGATGGACCTACCTGTCACACAGGGGAAGAGACTTGTTACTACACATCGGTTTTTGAT
CAATTAAACAATGATGAGGTTTGCCTTTGTTGAATTTGGTTTTTACCTTTTCCTGTATCA
AGAGACGAATTGAAATCTGAAGAATATCAACTACTTTCTTACTGAATCACAGGCTTCAGG
AAACAAGCTAGCATTAACAACATTGTACTCGCTAGAATCAATCATTTCCAAGCGGAAAGA
AGAATCAACAGTTCCTCAAGAAGGTAAACCATCATGGACTCGACGGTTGTTGACGGATGA
CGCTCTGCTTTGCTCAAAGATCAGGTACTTTGTCGGTTATCTGTATAATTGAATTTGAGC
TATAGATTCTTATGAAGCTTATTGGGATATTCGGCTTCAGGGAAGAAGCTGACGAGTTAT
GCAGAACACTGGAGGATAATGAGGAAGTTTCAAGAACACCATCAGAGATGGCTGATGTTT
TATACCACGCAATGGTGCTTCTATCTAAAAGGGGTGTGAAGATGGAAGATGTTCTTGAAG
TTCTTAGGAAACGCTTCTCTCAATCTGGAATCGAGGAGAAGCAAAACCGTACAAAGTAAC
CATTTTCTTCGATTGTCTGTTTAGTATTTGCGAGAATTTTTTTAGTTACTCGGAACTTAT
ACTGTTGTTCATTGTGCAACTTTGTATTGTATAAATAGATATCCTTTGTGATAAAAGAAA
TAAATGAGTCCTTTTTCCATCTTTCTACTTTCATTAACTTTTTCAGTTAACTTAAAAGAT
ATAAATGAGTCGCTTCTCTCCAAAATGTGTCAACCATCTCTGATCTAGTTATGCTCTATT
TGACATCATGGTTAAATATCCTTCTAAAAGAGCACCAAACTTGAGCTTCCAATGCCGATC
GTAGTTTGGATCGAGTAACCCATAAATATGATCTTAAGTCCTTAGTGGCAGTCCAGCGAA
AAGAAGTCATTTGATCAAACTTGCATGCATACTTGCTCTTTATCCACCCTGAATCTGGTC
ATATCCATTCATCTTCCAGATAGCATTATTCTGCCACCAACATATAGGTGATTTTCGGGT
TTCCTTGAAGACATGATACAACTTGCTGCGTCAGTCAATTTATTAATCAAGAGGTCCTTA
CTCCAACATTTTTTAACTCTTGCAAAGCAAATCTTTAAGACCTTGATAATAATAGTGTTT
AAACCACATACTAATATATCTATATATTAAAAATATAATTAAAAAATATATAATATCAAT
CTATACCGTGAAATACCCAAGAAATTAAAGAGAACAAAAAAAGGAGATTGTTTATAGAGC
TATATCTTGGACTCAAAGGACTAGATCCTTCTCTCTGTAGTGTGCATCACAGGAGATGAT
AAACACTATGATACAGGTGGTCTCATCAAGAGGTTTGGTTTGACGAAAACCATAGCTTTT
TCTGGCAAACCAGAATCTTCTCACTTTTGACTGCATACTCAGTCTCCTCTCTCCGGCAAC
TCCACCTTATCCCTTTCGCTAACGTTGTGATTGCGTCCATGAAATAACTCGATTCTCGGA
TTATAACATATCCACTCGGCCGCAAGATCCTGTCCATCTCTAGCAAAATGTACTTCATCT
CACACCTGAAAACATTACCATATGGTTCAACAAACACATTAACACCAAAACCAAACACTT
TCTAAGGCATTCTTTAAAAACAGTTTACATTTTCTTCCTATTGAGTGATATTGACCAATG
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1230, 2420..2665, 2742..2837, 2932..3083, 3160..3500
1078..1230, 2420..2665, 2742..2837, 2932..3083, 3160..3358
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved