Arabidopsis_thaliana Locus Ploy:SnoR78-2
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Ploy:SnoR78-2
Arabidopsis_thaliana
Ploy:SnoR78-2
SnoR78-2, SnoR78-1
1001..1125, 1281..1388
2388
GGCACAGTTTGCAAATTTCACCATCCTAGAGACAGACAAGCTCCTCCTCCTGATTGTCT
CTTAAGCTCCATTGGCCTCCCCTTACGCCCGGTAAGCTCAAAGACTTGTGCATAATTACT
TGGTTCTCTTCGATTAAATCTCTGCATTGTTTGATTTTTTTTCTTTCTCAAAATGATAGG
GAGAACCGTTGTGTGTGTTCTATACACGCTATGGAATCTGCAAATTTGGTCCAAGCTGTA
AATTTGATCACCCAATGCGAGTATTCACATACGACAACACAGCTTCAGAGACAGATGAGG
TAGTGGAAACATCAACAGGGAAATCTAGAAGACTCTCTGTGTCTGAAACAAGACAAGCAG
CAACAACATCCTCTGGTAAAGACACTACCATTGATAATACACAGCAGTGAAGAAACAAAG
GAAGAAGAAGAAGAGCTTTTAAACAAGAAGAAAAACAAAAGCTTTTTGATTTTTCAAAAG
AGGAATCTGTAAATTCTCATTTTCATTTAGTCTCTCAAGCATTTATTAATAATGTATAGA
GGTGATTTATACAACTGATCTTGATCTTGATCTGATCGCCATTGTTGTAATATTCTTTTG
GCGAATCAGGTTCAATAAAATTGAAAGTAATTTCCCTCATATTTGGCTTTGACCATGTGC
ATTGGTGCGATTAAAATATTTCGGTAAAATCAAACCCAAATGTGTTAAACTGGAGCCTTG
TTTTTTCTTCAACTCATAGGCCTTTTAAAGGTTGGACCTACCGTAGAAATAAGTTGGGCT
ATAAATAAAGCCCATATTAAATTAAAACATTCTAAACCCAATAGTTGTATAACCGGCGTC
GTTTTGTGCTTAGTTCCATCGGTTGCCCTAAACCTCTCTGTATAAACTTTGCGTTTTTCT
TTCTTCCGTTACCTCCATATCAGTTTTTAGGGTTTAGTGTTACAGTGGCGGAGATATCTT
AGTTTGTGTTGGTGTTTTCTTGTATGAGGTCATCTAACAAAGCAAGATAGGTTATAATTT
GTACCAATTTTGTGTCGGAAGATGACAAGATTAGTTTTATAGGCCTCCATGGGAATTTCT
TCATGGAACTCTTCTCTTCCATGGAGTTGCTCTGAGGAGGTTACACTTCCATAGTCGTAT
GTATTTATCTATGTCCGAATCAAGCTCGTTGATCAAATCATAACCTTTTGTGTTAGTTTT
GTTTTTTTAACACTCTGAGCTACTGTTTTCTGGTGTCTGATGAGATTCGTCATCCTTAAA
GCAAATAGGTTATAACCTCTGTGCCAAATTTGTGTCGGAAGATGACAAGATTGATTTTGC
CTCTCCATGACAATTTTGCTTCATGGAAATCTTCTCTTCCATGGAGTAGATCTATGGAGA
GGCACATCATTGTGCAATTGGTAAATTCGTCTGATCGTTTTTTTATATGTGTTTCTGCTT
TTATTATCGGGAGAACATTATTACAGCAAGATTTTGTGTCTGAAACAAGAGAAACGATTG
TCCATTGATACTTATAGCAGTAACAAGCGAAAGAGTCTGTAAATGATACAGAGCATTCTT
TGATATGATTATCCAAAGAGGATCTTATTGATGAAGAGTCTGTAAATTCTCCTTTTCCTT
ATTTATAAAAGTCCGTCCTTATTACAAAGCCGTAGAATGAATTTGCAATGTTGAAATATG
GATGAAATTTTGAAACTTGATTCCTGGCGATAATTTGTGCTTTAACTGAAGATTAGGTAA
TTTTCAGCATTAAGATAGTTTGAGAATTCATGGCTACGATGATTGAACCAACTGGCTTAT
GTTTTACCTATCTGCGTTAAATTTCGTGGTAAACTGAACCGGGATGTAATGAATCCGGTT
TTGGTTTGATTTTTTTTAAATGAAAATAACTTTCTGTGGATCTTTTAATCGAAAATAATA
TTGAACGTTACATAATTGGGTGAAAATTCGTATTTATCAGATATTTGGTTTTGATCGAAT
CTTCGTGTGGTTTATCTTAGATACTCGAACTTTTAAAGCAGTGTATGAATCTACGCGTAA
AATATTTAATGTATTGAAGTAATATTGGAAAAACAATGACGCGGGGAAAAGTAAACAAAC
ACGGACCCGACGACGGATAAGCGACCAAGCCCGAGTCGCATCGTCTTGGTCTTAAGTCTT
TCCCTACTCGTTTTATCATTTTCTTAAACTAAAAACTAATTTAATCACTCTTAATTATTT
ACTTTTTTCTTTTAATTCAACTATGACTAATTCTTATTCACAGAATGAGTCTCACATGCC
TACTCGTCGTACTCGACTCCAGTCCAAATGTTCCCATACTTGTAATCTATACTACATATA
TTATACGTCATCGTCATGTATATACAAGACTCAATATATAACGTCCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003074.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved