Arabidopsis_thaliana Locus Mono:h-127bSnoR76
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:h-127bSnoR76
Arabidopsis_thaliana
Mono:h-127bSnoR76
1
h-127bSnoR76
1001..1066
3168
ataggcatttattttggttatatatttactttaaggcacttcttacataacattcaaaa
acagatactcttccctggtgaaaagtcatctatatcctccagtcattgacatcatcttct
ccaaagaattgttgaatcacagaaaactcccacgaaaaatatcccaaatcctacaacttg
cactttcctattcttctttttcttcctttatctttccaagaaaccaaagcatagacacat
caacttgaaagagagaaagagtttgatttgattaaaactaaaattcaataaaatctataa
atttttttgcttgggttctctatgtactatcttagggtttagtattgtataattaaaaac
gattttaagtttgcttgaaaaataatgaagaaattgatttggtcagattttgcaaccatg
ctcgatgaagaagaagaggaaaagaagaaaggggaagaagaagaggagaagaagataggg
gcaaaattgtctcaattaaagtaataagtcgacactattatattctactgtagaacatac
ctattttgaaagaactttatttaaaatgcctattttgaatataagctctatatttattat
taaagcaatatcaaaaacaataccttagtttgctttccaaaattttaagttggactaaga
tgtcagtaaattaccaaaaaattaattgtatgcatttgtgttaagcaagttaccaaagtc
aaatagttaataacttaataacgttagatttgggtgtgaataaaaaaaaccaaaccagaa
ttattaaatttgatttcagtggatataaatttctctcaagaaaacgacattaacgaagga
gagccaaagcttcgtcgttgatcattcctccgtagttgcggaattgaacccaacttaggg
tttgtttacttctcatttctctcttcaatttcgtctcttgcttccatttctcaactcaaa
atcgtaaatttcgcggatttttttgttcaattcagaatcaaatgcccaagatctgctgct
ctcgttccgctacacaagtaaaaatccaaactttttttcatttcctcagtgttttctgta
aagttttgtgatctttggtaatgttttaaggttgtggtagcacaaaaatcaaactcgggt
aaaggaagaaacggtgaaggaggaatcaagtatggatttagtttgataaaagggaaatct
aaccattcaatggaggattatcatgttgctaagtttaccaatttcaatggcaatgaattg
gggctttttgcaatctttgatggtcataaaggtgatcatgttgctgcttatctgcagaaa
catctcttctctaatatccttaaagatgtaagctttattaaagattgttgcttttttgtg
tgtgtgttatgtatgtttagtatgtgtgatgatagtttgatgtttacttctagggagagt
tcttggttgatcctcgaagagcaattgcgaaagcttatgagaatacagatcaaaagattt
tagcagataatagaacggatttagagagtggtggttcgactgctgtgactgcgattttga
tcaatgggaaagctttgtggatagctaatgttggtgattcacgagctattgtttctagtc
gaggtaaagcaaaacagatgagtgttgatcatgatcctgatgatgatactgagaggagta
tgattgagagtaaaggtggatttgtgaccaacagaccaggttaagagcagcttttagtga
tctttcattatataaggttattagatataaggatgattctgatgtttgtgaattgaacag
gtgatgttcctcgagtgaacggtttgttagcggtctctcgtgtctttggagataaaaacc
ttaaagcatatttgaactcagagcctgagattaaggacgtaaccattgatagtcacacag
attttcttattctggctagtgacggtatttcgaaggtaaagttgcgaattgtagtctgga
tttgagtaaaggataaatggtgtttattgaagtgagtttttggttgaacaggtgatgtca
aaccaagaagcagttgatgtagctaagaagttgaaagatccaaaggaagcggcgaggcaa
gtagttgctgaagcattgaaaagaaacagcaaggatgacatatcttgcattgttgtccgg
tttagatgataaccaagaagactcagcttatattggatttggagcttcctttgcttcacc
atgattcttttggggtccggtttagtttgattctgggtcttggttacttgtgcattttta
agaacatgagtttgaataggactattatatattactagtttgacaaaccagatattttat
catataaattacatgaaaagaatagtcgattttaaatggtttcaatttgttcttggaatc
gtggataattaatcatctactcattaatcaatgttaacaagaaaataaacaatcattcag
tcaactgcattcatatcagacagactcattatttttctgggctttattgaaaaggcccat
tatagcccataaaacgttagacctaaagggaaattagggtttctgaagctggaggcggac
actatatataccaatgctcttctctgttaacataatcgtgttcttgatggttctcaaagc
cgaatcgtttttctttcaaatttgttctcgtttaatcattgatgatagactaagaaaatt
agggttttttatttttggtttttgataaagagaaagatgcctcttctttcagcagcaaga
ttattcttgttagctttgttctggaggcacagatcaatcgccattatgagagggattttt
ttataatttgcagagttgttcttccttctttgctgattatccctctttgtggtacataat
ctcttagtttttcttcgtattaacataatagtgttggagtgaggattttgatgaaagaac
atcatggcggttggcgactgaataagaggatttaaacgttgcactacgtgacattgaaac
tgtctttcaacattccaatatttcaactttcgaatacccaatatttggtttgttcaaaga
cattttcgatgtctagcagtgccaatgtttaaaatcaactgataattttggaattaatgt
gtataaagattcgaacttttatttgtttgactctgattgtattctcttt
  Untranslated Region
  Coding Sequence
  snoRNA
CP002684
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved