Arabidopsis_thaliana Locus 60S ribosomal protein L17 (RPL17-2)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana 60S ribosomal protein L17 (RPL17-2)
Arabidopsis_thaliana
60S ribosomal protein L17 (RPL17-2)
1
SnoR74-1
1416..1548
3631
TACCACCAAAACTCCTCCCTCGTGGTGCACCATCAAATAATCGTCAATCCACTCGTTAA
TATGTGTGATGATACGCTTATCAGCGATATCAGTAGATGTTGAATCAACTCTTCAGGTTT
CAATGATATCGATAGTATACTTAGCTAGTTTCTCCCCCATGAAATCGATAGAGCTTCCTC
CCAAGGTATTCAAGATCTTATTGGCTTCTACATATGAAGCAATCATTACTCATGTAGCAA
ACTTGTTAATCTTCTATATTTTCATTACATATAATATTTTACGTACAAGTAAGTCAAATG
ACATGACATGACATATGATATAACTGAGTAAGTAAGAAATTACGTATAACAATTAAGTCA
AATGACATAGTAACCATTCGTGATTGTTGTCTCATATTTATATATATAAAACAAAAAATG
AAGTTTTAAGCAAATGATCTACAACTAAAACAACATACTCCACCAATATATACAAAATAC
GTACACTTTTTTTTGATAAGTAAGTAGAATTCTATTGAACCTGATGAGAGTTGAGCATAA
CTCTATTCTTAGACCCGAAAACTACTCACCATGTTTATTTTAGAGATTTAATGATGGATT
GGACAGTTTTTAGGCCATATTACATAGTAACAACTAATTTCAACTAAAAGAATGCAAGTT
GGTTAGTTTAATACAAAACAAAATAGTGAAAATTGGATCTCTAGCTCATTTTCCGATTAA
TTAACTTATTTTCAAAAAAATTGTGGTTATAAGAACGAATTAATCAATTGCATTTCTTAT
AAAAAAAAGTAATGAAGAGAGATTTTACTTACATAAAATAAATACATCTGGCCTGATGAA
ACAAAAATGAGTAAGGATATCAACCTTTGTAATAAGTAATTGTTAATTACCAATTCATAG
TCTTGATGGGCATTATTAGAAAGCCCATTAAAAATGGACAAGGCCCATTTAAACCTAGGT
TTCGCAGGGTTTATTGCTTCACTCTTATATAAAAACTCTCGTCTTCACAAATCTCACATC
TCTTCTGCAGCCGATTCTTCTATTAGCCGCCATGGTAATTGCTTAATTGCTTAAGCTTCT
CAAACTCCATCTCTCTTCTCGCTGATTTGACCTAGAAATCTTCTTCCCTAATTTTCTTTA
CCCTGTCTTTGCTGATTTCGCAGGTGAAGTACTCGCAAGAACCCGACAATCAGACCAAGT
GTAAGTAAAGCTCCTTGTATCAACTTCTTAGTACCATTTCGTTGTTTTGATCTTTGTGGT
AATCCTTTGGTTTTGATTTTGCAGCTTGCAAGGCTAGAGGATCCGATCTTAGGGTTCACT
TCAAGGTATGTATAGCTCTGTCAATTGTCATTTTGATTATTCGATGTAGTTAGATTTATG
ATTAGGAGATTGTAGTTTTAGGTTAAACCTGATTGAGAAAAAGCAGAGTTCTGTTGCAAT
TTGACAGATCTCACGTATACTTCAGGGAAATTGAATTGGTCATCGTGATTGGGTGAATCT
ATGTTTATATATCTCATAACTATAAGATTCAGTACATGATGGTACATTGATTTATCATTT
CACTTTTTGAGGCTTGTTTATTTTTAGGGCTTTTGGTTAATCGCTTAGTATTGCTTTGTT
ATTGTTCTTATGTGAACCTATGTAGAATTTTAGTGACTTGTTGTTTTGGTTAGTGATTCC
ACATAATTAATACTGTGTTTTTGAATTTGTTGGTTGGTTCTTATTGTGTTTTGTTTTCTT
CGGATTGTGTGAAACAGAATACTAGGGAAACAGCGCACGCAATCAGGAAGCTACCATTGA
TCAAGGCGAAGAGGTACCTTGAGGATGTGATAGCTCACAAGCAAGCAATTCCCTTCACAC
GTTTCTGCAGAGGTGTTGGGAGAACTGCTCAAGCTAAGAACAGGCACTCTAATGGTCAAG
GACGTTGGCCAGCCAAGTCTGCTCAGTTTGTTCTTGATTTGCTCAAGAACGCTGAGAGCA
ATGCTGAGGTGAGACGAGCATTCATTTAATTAAGGAAACTTTTTCTTGTTTCTCTCTGTA
CCCTTTTGCTAATAAGCATATTTTGACTTTGAATGTTCAGGTGAAAGGTTTGGATGTTGA
TGCCCTCTTCATATCACACATCCAAGTGAACCAGGCCGCAAAGCAAAGGAGAAGGACTTA
CCGTGCTCACGGAAGAATCAACCGTAAGTTTGAGATTTTGTAAATCACTTACATTGATAG
CTTTTTGTAATCCATTGTATGACTCAGTTTGTCTTTCTTGGTTGCAGCTTACATGTCCAA
CCCATGCCACATTGAGTTGATTTTGTCAGAGAAGGAAGAGCCTGTCAAAAAAGAGGTAAT
ATATATTTCATCTCATTGGAAAAATTCAGGACTAGTGTTAATAACAACAGTGTTCTCATT
TCGTATTTGTTTTTGATAATTGTAGCCGGAGACTCAGTTGGCTGCCAAGTCCAAGAAATC
AGCAGCTTAAGCTTTCTTTCTTTATTTTCATGTCCCTTGTGTTCTTGAACGAGATTTTGT
TCTCTTTTTTCTTTAGCTCGAATCGTTTTGTAAGACAATGGATAGATTTATCTTGGAAAT
TTTCGTTCTATGACTTATGAAATCAGTGATCATGGTTCTGCAAGTTTTGGTTAGTTCGAT
AGTTCGATTAGTCAATAATTCAGACAAACAAAAGAGCTGAGAACTTAAAAAGATCTGTAC
AATCTTTTACATCATGTGACTTAGTTATAGTGGAAACTTGAGTTCTCTCATTGTCTTTTA
TTCTCATTCTCAATGGCTTGGACGATTGGGTCGTTCTCTATGTACAAATCACTGTCTTCA
TCTTCGAACTCATCCAGCTCACTGATCATTGTCTGTTTCGTTTTCTTCCTTGACTCTCTC
CTATGCTTCTTAGGCATTAACCGTGGTTCAGCATGTTTCACACCCATGTCTCCCACCTTG
TACCTGTGTCAAGTATCATTCCAAAGTAAACAACATTAGTGACTGCGACCAATCTCAATC
TAAAAATAAAGCTGTTCTTTCAGGAGAAATCCCAACAATACCTAACATCATCTTCCCTTT
TGGTTCCAAAAGTCCTAAGCTGAAATTCTTCCCTGATTCTGATCTCATCAAGCAATTGTA
AGTAGTAAGGATACCTTTCCCAGTCACCTTTCACAACACATCCTGGTTCCCCAATATGCA
AGCAGTCTCTGAATCCACATTTTTCGCTCTCAATCATGTTCCGTATCTAAAAGAAACAAT
TAAAAAGTAACACATCGTCACAGTCAGCCAATAAGGGAGATTGGCACAAGCAAAAGGGTA
CAAAGAACAAACCTCAGGAAAACAGTGAGCTAGTGAATGCTTCGTTACTTTCAGCAAACT
AGGCTGGTTAAAGCCAGGAGTATCAGCGAGGTAACCACCTTCAGAAACCGGCAGTAGCGA
TACATTTCGTGTTGTATGTTTACCTCTACCACTTCTACTCGAAACTTCCCCTACTCGCTG
ATCATCAAACCACTTATTACCTAACATCTGAATATCACAAAAGCTCAACTCATAAGAATC
TGGCAAACAAAACTTAAGCTGTAAAATGAAATAACACAAAAGAACCTTACAGGCTCAAAC
CAATTCTCATCTTCCACCACACCACCACCATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1053, 1163..1199, 1284..1324, 1757..1987, 2080..2182, 2267..2334, 2425..2631
1051..1053, 1163..1199, 1284..1324, 1757..1987, 2080..2182, 2267..2334, 2425..2469
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved