Arabidopsis_thaliana Locus 60S ribosomal protein L17 (RPL17-1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana 60S ribosomal protein L17 (RPL17-1)
Arabidopsis_thaliana
60S ribosomal protein L17 (RPL17-1)
1
SnoR74-2
1494..1616
3806
CACTCACAACAACATAAAAGTTTCAAATTCAAAAGCATAAAATCTGAAAATGCACCTCA
TTTTCTGCTCTCTGGAAATATTCAGTGGCTTTATCAAAGTGCTCTTTTGCTTCTTCAGGA
TCGTGAACATAAAACGCGTGGGCGGTGTACGCGTTGGCAATACACCAAAGAGCCTGATGC
TTCCCTGGATTTATTGTCAAGGCCTCTTCCAACTTGGAAATAGCATCTACATGATCAATA
ATATTTCGTTACATTTCAGAGCAAAGATGAATTTGAGGCGTTTATTTTAAGACATTAAAG
AAGAGATCATACCATTTAACATGAGCTTAGCTTCAGGAATAGGCTGGAACTGTGAAAGTT
CAAGTAAAGCTCCACCCCATTTCAGCAGATTCTACAGAAAATAAAAATGTTCGCAAAGGT
ATTCTTAATATGACCACATATCAAAAGAAACTCAGGAAAAAATGTAATTTCAGAGAAACA
TATAATCAATCTCATAACATAAATTATAATATTTCCATCGAATTCAAGACCTAAACTACA
CATAGTGACAATACATTCACGAAATCCATCTCCACAAAACATCCTTAATATTCGTTACAT
ATCAGGTCCGATCATATTAATCGAAATGAAGCAATTTCACAAATTCTGAGGAGAGGGGAG
GACAAGTAGAAGAAAGAAACCTCGGAATCAAGAGGATCGTTCTTGTACTGAGCCTCAGAA
TTTTTGCGAGCATGTTCGAACATGATAAGCCTTTCAAAGTCGGCGGTAGAGAACTCCATC
TTCAGATTCAGGTGAAAGAAAATCTAGGGTTCGGTGTTTTTGTTACTGAGAAAAGTCTAA
AGAGTTGTCTCGATGTGAAACAAGTTCCGAGGGTTTTAGCCTACAAGTCGGGTGTTACCA
GCACATAATTGGGCTTTTTAAGCCTACTTATCAAGATAAGTGGCCCAGAAGGCCCATATG
AACAAATAGTACTTTAATACACTAGTTCAACTAATGTATTCGCCGATTAGGGTTTCTTCT
GTTTCACTATATATTAAGTGTCTCCAACTACTGAGATCTCTATCCTCTCCGTCCTCTGTT
CTTCTCATTGGCCGCCATGGTAAATGCGTTACACTAGACTCGTCGTTACAACGTTTTCAC
TTCTAACTTATGCTCCTATACTTATGTTCTTCGTCTTCTTATTGTTTTTCTTCAGGTGAA
GTACTCTCAAGAGCCCGATAATATCACCAAATGTAAGAACACTTTCATAGTCTCTGTTAT
TTTTTGCTTCAAGCTACACTGTTATTGGCTTACCTCAAGCTATGCAATGAGTATTCATTG
AAATGGTTTCGATTGGTTTTGCGTTTGCAGCTTGCAAGGCGAGAGGAGCCGATCTCAGGG
TCCACTTCAAGGTAAATTTCTTGTACTGATTCCGGATCTCAAAAATGAATTAGATTAAGT
GATTTTCCTATGGGGATTAAGCTTGTAGTTTGAATAAAACCTGATTAACAAAAAGCAGGG
TTCTGTTTTATATAACAGACCTCACGTAAATGTCAGGAAAATCGAATTGGTCATTGTGAA
TGGGTGAGCCAATGTTACTTCTAATAGCATATGGTTCAGTACATGATGGTACATTTTAGC
TTAGCTCTGAATCCTTTTTCAATTTTCAGTATTGTTGATTAGGTCATGATTGTAGTATCT
GGGTTTGTATAGATGTAGTCGTTCAATAATTTGCAATACACCAAATCATTTACATTAGGT
TTGAGGTGCTAAATGTTACTGTGCCATTAGGTAAATAATCACACTGAACAGTATTGTTGT
CATTCTAGTTTCATTGTTGATGATTTGGATGTGTCTAATTGTGTTTTTGAATTGAATTTG
TATGAAACAGAACACTAGAGAAACAGCGCACGCCATAAGGAAGCTACCATTGAACAAGGC
CAAAAGGTACTTGGAAGATGTCATAGCTCACAAGCAAGCTATCCCCTTCACCCGTTTCTG
TCGTGGTGTTGGTCGTACCGCTCAGGCAAAGAACAGGCATTCGAACGGACAAGGTCGCTG
GCCTGCTAAATCTGCTCAATTCGTTCTTGATCTTCTCAAGAATGCTGAGAGCAATGCTGA
GGTTGGTTTTACGACTCTTTTTGTTTTGTTGCCATGGTGATTTTAGTTAGTTACTAAAAC
TTTTTGTAAACCATTTGGTTATCAGGTCAAAGGTTTGGATGTCGATGCCCTTTTCATTTC
TCACATCCAAGTGAACCAAGCAGCAAAACAGAGGAGAAGGACATATCGTGCTCATGGAAG
AATCAATCGTATGTCTTCTTTTCTATTCGACTGTTTTTACAACGTTTGTTTCTTCATTCA
CATTGTGCTGACTCTCGATTTAATTCTATCTTATGCAGCTTACATGTCAAACCCATGCCA
CATTGAGTTGATTTTGTCAGAGAAAGAAGAGCCTGTGAAGAAAGAGGTAATTTAATGATC
CCAACGCCTCTCTGAATATCTTCAAATACTTATATTTCATCTTCATCACTGATCTCACAT
AATTTTTGTTGGGTTCTTGCACAGCCGGAGACACAGTTGGCAGCAAAGTCAAAGAAAGGA
GCCTCATCTTAAGCTATAACATAGACAGTCTATTTGTGCTCACTTGTGTTACCCTTAATA
CTTTTTGTTAGCTTCTCTCTATAAGACCAATACTCAATTTTTAAGTATGATGATTATCGG
TTTTTGGATTGCTGAAAGAATCTCTCTTTATCCTTGGTATTGATAGATGAATAACTCATA
GTAAAATCTTGAAATATGTTTTAGAGATGGATTAGTTAAGACTTGTTAAATCGTCGCCCA
GTTTGTTCATAACGCTCATTAATATAATGACCAATACATCGACTACACAGTCTGATAAAA
CGGATGGATTAGTTTTGAACTCGAGAAAGTTCGAAATGTTATGTTACGTAAGAGCAAGTA
ACACTTTCATTCGTTTGTAAAACCCAAAACAGACCCAATCATAAATCATCATAAACGGCC
CAAAAGACGGAAGGAATCATCGTCACTAAGTGGGCAAACAAAAATGGTGAAACTGCAAAA
CACCTGCAATTTCAATTTTCAAGGAATCCGAAATGGAGAGTGGTCTGATATCAGTGGATC
GATGGAGAAATGGAAGTCAAGCCTACTTCTTGACTCATATACACTCCGATCACACTCGTG
GCCTCTCCGGCGGATGGTCCCAAGGTCCTCTCTACTGTTCCCGCACCACCGCCTCTCTAT
TTCCCTCCCGTTTCCCAGGTTTCGACCTCTCCTTGCTTCGCGTCGTCCCTCTCTTTTCCT
GGACATCTCTCTCCCTCCGCTCTCCTTCCTCCGGCTCCACAGTCCGCCTCCATCTCATGG
CCATCGATGCTCACCACTGTCCTGGTATGATAAAAGTCTAATCTATTTCTATATAAGGCT
TCGCTTTCTCAGTGGTGAAATTTGAATTTGCTGGTATAATGTGGTAGGATCCATAATGTT
TTTGTTCCGGGGAGATTTCGGATGTTTTCTCTACACTGGAGACTTCCGGTGGGATTCTGA
TGCATCAGACGAAGCTAGAACCACTCTCGTTGCTGCTATTGACGAGTTTCCAGTCGACAT
TCTCTATCTGGATAACACTTACTGCAATCCAATTTACAGTTTTCCTTCCCGTCTAGTCGC
TGTTCAATTGGTTCGACCTAAACCCTAATCCAAAAGCCTTAAACCCTGAATCATGTTTCT
CTTTGTTATATTCCTCATCTCCTTTACTTGCAGGTTGCTGATATAATTGCTTCTCATCCT
TCACATGATATCATCATAGCAGTTGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 1195..1231, 1350..1390, 1870..2100, 2185..2287, 2378..2445, 2544..2806
1096..1098, 1195..1231, 1350..1390, 1870..2100, 2185..2287, 2378..2445, 2544..2591
NC_003070.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved