Arabidopsis_thaliana Locus ARF1A1c (ADP-RIBOSYLATION FACTOR 1)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana ARF1A1c (ADP-RIBOSYLATION FACTOR 1)
Arabidopsis_thaliana
ARF1A1c (ADP-RIBOSYLATION FACTOR 1)
SnoR73
2086..2200
4218
TTTGATATCCGAAAGTTTCATATAAATTCCATATATGATTGTTAGCTTTTATTTCCATG
AAATAGAAAGATGGACTACATACCTTTCAAACTACTGTATTTGAAGCTTATGTCAAAAAT
ATTTAATTAAAATATATGTAATTTATATGTTGATTGAGTTATGAGTATCAAGTAAAAACC
CTAATCCGTTATTAAAATATCAATGATTATAACGTATTTATAAACGAAAAAAAAAAGAAC
ATCTAGAATTTTCGATATTTGATCCTCAAGTTAAACTTGGAAAAATTTGGATGTATGAAA
TATTTTGTCGTCCACTTATACAATAAAGTATGAAACATGGATGCATGAAGGCTAGACATC
CAATGTCTAAAAATACTATATATAATGCTTTTGGTAGGGTCTTTTCTTTATCATGTCTCA
CTTCTGTTTCTATCCCTCATTTTAAATAGCCAATATAATTTCACTCTTTACTATAAAATT
ATTATATAAACATCATTTTGATTGAACTACCTAAAAGGAAGAAACGTATAGGAATTTTTG
GAGCCTCAAGATTGTAATAATGTCTCATAGTTTGACTTGCAAAAGCTAAATTAAACGCCT
AAATCATTACCATTAAATAAATGAACTTTTGTACGCAATTGATTCAGACACAAGGACCGA
CCAATTCGAAAACAATGAATGGATATGATTCATCCTTATGAAAGCTTGACAACAAACTCG
GTTTTGGCTGGTTAACCTAGACTCGGTTTATTTAAACCAGACAATAATTTCTTTCGTCGT
CGTTTTATTTGAATAGGTGCGTCAAAAATAAAAGCTGAAATTCTTGGTTGCAAAAGCCCA
ACAGGCCTGTGGAGATAGCTTTTTAGATTGATTAAATGGGCCGAATTGGGCTGACACATG
ACGAGAATGTGGCTATAGAAATTGTTAGTGAGAGGGTCCGGGTCCAAAAATGTTGCAGAA
GTGATATAGTATTTATTTAATTAAAAACATATTATTCGACGTATTTTTAACGCTCACTGG
ATTTATAAGTAGAGATTTTTTGTGTCTCACAAAAACAAAAAAATCATCGTGAAACGTTCG
AAGGCCATTTTCTTTGGACGACCATCGGCGTTAAGGAGAGAGCTTAGATCTCGTGCCGTC
GTGCGACGTTGTTTTCCGGTACGTTTATTCCTGTTGATTCCTTCTCTGTCTCTCTCGATT
CACTGCTACTTCTGTTTGGATTCCTTTCGCGCGATCTCTGGATCCGTGCGTTATTCATTG
GCTCGTCGTTTTCAGATCTGTTGCGTTTCTTCTGTTTTCTGTTATGAGTGGATGCGTTTT
CTTGTGATTCGCTTGTTTGTAATGCTGGATCTGTATCTGCGTCGTGGGAATTCAAAGTGA
TAGTAGTTGATATTTTTTCCAGATCAGGCATGTTCTCGTATAATCAGGTCTAATGGTTGA
TGATTCTGCGGAATTATAGATCTAAGATCTTGATTGATTTAGATTTGAGGATATGAATGA
GATTCGTAGGTCCACAAAGGTCTTGTTATCTCTGCTGCTAGATAGATGATTATCCAATTG
CGTTTCGTAGTTATTTTTATGGATTCAAGGAATTGCGTGTAATTGAGAGTTTTACTCTGT
TTTGTGAACAGGCTTGATCAAAATGGGGTTGTCATTCGGAAAGTTGTTCAGCAGGCTCTT
TGCGAAGAAAGAGATGCGTATTCTGATGGTTGGTCTCGATGCTGCTGGTAAGACGACTAT
CCTCTACAAGCTCAAACTTGGAGAGATCGTCACCACTATTCCAACCATTGGTGAGTTGTA
ACTTCATTTCTTCTCACATTGTAATTTTGTATGATGGATGTGATTTACTGTTGAATGTTA
CACTTGTTTTGTATGACAAGCTGACATTTCCGTTCCTCTTTGTTTTAAGGGTTCAACGTT
GAGACTGTTGAATACAAGAACATCAGCTTCACCGTGTGGGATGTTGGGGGTCAAGACAAG
GTATTGTTTCATGGTTTTTTATAACTCTGCATTCTATAGTCATTGTATGTAGTCGATCAT
CCATTTATGATGTCATCTGTTCAAAAGGGTTTGCTTATTAGGTTCAGTGTTGGTATTATA
TTCTTGTACCCACACTCTACAATTGATAAGCTAAATCAACTCAGCTGGAATTTCGAACAT
TCTTTGATTTCTCAGAGAGATGTTGTATTCTGGCTAACAAACCTATATTACCTCTTTTAT
CATTATGGACAATCTTATCTCATTTGAGTTATGCTTGATCTCTTACTAATTTAGTAACAT
CGTTTTTGCTCATCCAGATCCGTCCATTGTGGAGACATTACTTCCAGAACACACAGGGAC
TTATCTTTGTTGTGGACAGCAATGATCGTGACCGTGTTGTTGAAGCCAGGGACGAGCTTC
ACAGGATGCTGAATGAGGTATTTTAACTCAATACTTCCCTCTATACTTTGGTATAAATAA
GAACCAATATGGTTTTGAGTTTTGACTTTGTGATGGGTATTTTGGTAGGATGAATTGAGG
GATGCAGTTCTGCTTGTATTTGCTAACAAGCAAGATCTTCCCAACGCGATGAACGCTGCT
GAGATAACTGACAAGCTTGGGCTTCATTCTCTTCGTCAACGACACTGGTAAGTGAAAAAC
ACAGAAACTAGCTCTCTTAATCCACAATCTGAAAACCCCTTGACGTATGGGCTCATGTTA
TCATTTTGTAAACAATAGGTACATTCAGAGCACATGTGCCACCTCTGGAGAAGGACTCTA
TGAGGGACTTGACTGGCTCTCCAACAACATCGCAAGCAAGGTATCCACTAGTAGCTACTC
TCTCTCTCTTTCAGCAAATCCAATTTTGGTTTATAATCCGAGTCTGAAACACATGAATGT
ATGTTTCGCAGGCATAGATGGAATGTTAGCCAGATTCCTCTTCTGCTTGTTTGGTTTACA
AATCAAAGACAGAGGTCTGTTTCTCTAGTACTAAAAGATTTATTATTATATTCTTCTTCG
TCACTTATCTCAAACGCAGATCATTTTACACTTTGTACTTCCCCTTCAATAACTTGTTAC
TTCTCTCGTTTGCTTCCTGAATTTGAGTATATCATTTTTACATCTGCTTTTCATCAAAGC
ATAAAGCATCTTTCGAAACAAAAATTGAACCGAATTTTTCTGTAAACTGATCAAATGTGT
GAAGAAGACCTGTTATTTGGAATATTTATTTTGTCACTCAAGTTTGATATTCGAAGATAG
ACGCTAAAATTGAGGATAACACACATTATAGACAAAAAAGTAAAGCAAATCACATGTCAA
CGTCCAAAGCATTGGAACCAGAGACAGTATGTGTGGTTGTCGACCCGACACATAATCCCC
AACCTCTTACTGACCGGAAAGAAAAATAACTACCTGATCCACCGACAATTTTAACTCCTG
GCAACATTCAAGCAGCGGACGGTGCGGTCACGTAGTTGAGCCGGCCAGCTTCAGTAAGAG
CGGTGATGAACGGCTTCAGATTCACGAGATCGACCTCTGTGTCCACAACGGTAACAGGTT
TCTTGTAATCCAAGGATTCGTCGTCGTAAATGTCCCACCATTTTTTCACTAACATTTTTA
TATCTTCCCTCTCCATGTTCGCTTCTTTCCCTGTGTATCTCCACGGCTTCGAACCCTGTA
AAAGAGAAACAAATAAACAAAAAAACTCAGGACTGACTCAATTGTTTTGGATAAACAAGG
CCGTGAACAAAATAACTCACCGCTGCACAGTAGTGAACCACCTTGACTTTTCCAAGCTCT
ACATTTTCTGGGTGACGCCATAACATCGCAAGGACGAGATTGTACACTAAAGGAATCGGC
TTGTAGATTTTCTTAAAGTACATGTTCAAAAAATCCTGCGAAATTAAAATACACAACTTA
AAACAGATGAAAACAGAGCATAACAGAAAAAGGCCAGTCTGAGTTTTGATTTTGCCTTTT
ACCTGTTCAGCGAAAGGAGTCGGAGGAGTGATTTTAAGTGTTCGTAGTAGATCCTCGTAA
GTCTCGAGGTTAGGCTCGTACAAGAACATTCCGGCGTTGAAGTAAAGAGCCGGTGGCTCT
CCAAGCTCCGCTTTTGGCCACTGGACTTTGTCGGGGCATTGTTGGCAATATCTGATCTTG
TATTGCGGCGTGTGACTCCATGTTTTCTCACAGAAACAATCCATCACCGCGTACAAATAG
CCATCTGGTAGGTCAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 1631..1789, 1909..1979, 2297..2416, 2508..2626, 2718..2799, 2891..3218
1642..1789, 1909..1979, 2297..2416, 2508..2626, 2718..2799, 2891..2896
NC_003071.4
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved