Aspergillus_fumigatus Locus Mono:SnoR72-3
snOPY snoRNA Orthological Gene Database
Aspergillus_fumigatus Mono:SnoR72-3
Aspergillus_fumigatus
Mono:SnoR72-3
SnoR72-3
1001..1077
2077
TGTTTATGAATCATTGTCTAAATATTTTGTAATTTTATAGTAATTAAATGCTATCAAAT
ATCTCTGCGGTTTGATGATTATAATTGAATTGTAATAGTCATGCAGAAAAACAATATCAA
TAATGATAATTTTGTAGTAATTAAATGATATTAAATATTTTGAAAGTTTTATTTTAGTAA
CCAATCGTGTAGTTAATGTAGAGAGATTTTAGGAAAATTGTTAAATGTCAAATATTTAAT
TCGAAATTTTTTTTTCTAATTATCAAAAACAAATATTAAAATCCAGTGGCAACCATTGTA
AATAAGTCTCAACTACACGATTTATTTCACAAAATGGCTGCAAAAATGTATATATAGATT
ACAGTGTATTTTTTTTGTAAAAAAATATTTATCTTCGGAGTCAACGCAGAAAGTATAATT
AAAAATAAACTCTGGAATTCATGGAATCATGGTAACCAAAATATAAAGATTTTTTGTAGG
AGTCTAAAGATCGTAGTACACAGGCCCAGAGATGAGCCTTGACGTTGTAAAGCCCAGATG
CTAAACGTTTCAAACCCAGTACGTAAGCGAGTATATATAGATTAAGAAGTTTTTTTTGTT
TGTTTTGTTAATGATCGTATAGGATTAAGTAGTTGTGAGCTATATTGAGGTGCGATCATC
TAATCCTACTTTTTATTGTTCAATCTAAGTGATGCCTTCATATGCTTAATAAGTGAATAT
TGATGCTAACTAAATAAACAAGCAGTGGTTAATCAATCAAGTATTTCTTGATTTACTTGA
AGTTGCTTCAAACAAAATTCGTTTTAAGTGGAGTCAATAGATGTTACCAATTTGATTTTT
TTTTTTGTAGTAAAAAAGAACTGTTTTTAAGGTCAATGTTAATCAGAGTCTTCTTTTGTC
ATCAGGACTTCCGAAGTCAGATAAACATATTTCCTAGAAATGATTCCATGTCCCCTAAAG
ATGAAACATATAGGATCGTGAGATATATAGAGGCAGAAATTGAAACTCATATAGGTCTTG
CTTTGATACAGTTTGCTTTGATTTGATAAGCTAACTGTTACATTAACCTTGTTGAAATCA
CTTATCTTTTCGTTTGCAGTGTACAATCAACTTCTTATTCTACCTTTTCTTTTATATGCA
ATATGCGATTTTAAACTCGAATGACGTAACAACGGGGATATAAACAAAAAGTTATGTCCG
TCATATATCAAATTTAAACTTTATGTGAATTTCATTTAATATTCGATCAGGTAATCAATC
TATTGATTGTCACCGACTTACTTAAGTCCTCATAACATCTTTATTGTTACTGCTCGCACA
ACTAGTACCAATTTTTAAAGCAAATTCGTCATCTGCGAAACCCCACACTCACGCATTTAT
TATGAAAAGTTCCACACTAATTAAAGACTCCTAGTTTTGACAGTTGTTTTTTTTATTTTG
ATATTATGTTCAACTTCAAAAAAATTTTTATCTTTTATTTGCGGTTAAATAAAGAGTTTT
ATTTTGCCGACAAAAAAATAAAAATAAAAATAAAGAGTTTTATTTTGCCGATAACAAAAA
AAAAATATGTAAAGATTTTCGTTTCAACTTTACATTAAAAGAAGTGAATGTGACACGTTT
AAGCACATTTAGAGAATTTTATTACTTTTGAGACACTTTATAGGGATGAGACACTTTTCC
AACTTTTTCATTGAATTTATAACAAATTTGCCCCTACAAATGAAGAACGAGAATACTTTA
GCGTTTGACAGTTTCAATGTAGTTAGGAAAAAAGAAACAGATGGTATATGATGAGTGGGT
CGTTGGATGGAAGTTGTAACTAAGATCTGATTATCAGATTATATATATAATTTAATTACT
CAAAAAAGTAATATATTCTTTCTCTATTTTTACTTTTTTTTTCTTCTTCTTCATCGTCTA
CTTCTTTTTTTCCTTCATCGACTCTTCTTCTTCTTTTCTTTCTCTATCTATCTCTTTTTT
CATCTTTTAGTCTTTCTTGCAAAATCAAACATGAGAGACTTTGTCAAAATCATGTAGCTT
CTGTATCTTCCTTTACGGAGAAGCCTCTCTAGATTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved