Arabidopsis_thaliana Locus resistance protein (TIR-NBS-LRR class)
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana resistance protein (TIR-NBS-LRR class)
Arabidopsis_thaliana
resistance protein (TIR-NBS-LRR class)
SnoR72-2
6836..6912
8563
AGCCAAAACCAGAATCGGAGAACCATAGACGCACAAAGATAGATTTGGAGCCCAACTCG
CCGGAGGTTAAGTCTTTAGCTTTCTACTTTCACTCTATCTCTCTATGGCTTGTTCGTCTA
CTTCTCTCAATTGGGTATATGATGTTTTCTTGAGCTTCCGAGGGGAAGACGTCCGCATAT
CTTTCCTTAGCCACTTTCTCAAGGAGCTCGATCCTAAACTGATCACTGCTTTCAAAGACA
ATAAGATCCAGAGAAGCCACTCCCTCTGGCCCGAGCTTGTACAAGCGATCAAGCAATCGT
TGGAAGAAAGCATTGAGTGATGTAGCTAATATGTTTGGATTTCATTCTGCGACATGGTAT
AAAAATAGATGTGGGTGTAGAGTTTGAGTACTAATAAGAACCTGAACAAGTGAGATGTTG
GACTATACGATGAAATTGAGAGCTAAAGTTTCGAGCCCATTGGGCTTATATTTCAATTTT
TTCTTTTGTTTTCAGTCTGTTACAAAAGCAAGTCATCTTATTCAATAATATATGTCTTCT
TACTCTAAAATTGTAATTTCTCAAATTTAGCTACAAAACCAGTCTATCTTTGACGTTGGT
GGTATTATTAGCTCATTAACACACACACAAAAATGTCCTTGTTGGATATAACGACGATTC
AAAAATCTAAAGACAAAGAATTGACGATTAACGCGTGAAGAAGACTTGGGGAACCGCATC
AGTCAAAAAGTACAAAGACTAGTATTGAGTGACCAAAGTCAACAAATAGTAAATGTTCTG
TCAAGTTGCATATAAGAAAAGTCTGAGAAATTGCTACTAAACCACACTATGCTTTCGCAC
AAAAAAAAAAAAAAAAAAAAAACCACACTATGCTAGTGCTGCCTGCAAATTTAGGGTTTC
TTAACGACGACGGCAACGCTTCTTCACTTTTCTTCTGATTGCATTCTCAGTATCACCAGG
TCTTAAGTTGTTCTTCTCAAAATTACATTCCTTTTCTCTATATGGCTTCTTCTCGGAATT
GGGTTTATGATGTCTTCCCGAGCTTCAGCGGAACAGATGTCCGTCGGAATTTCCTCAGCC
ACTTGCTCAAGGGGCTGCATAAATCCGTCAATTCTTTCAGAGACCAAAACATGGAGAGAA
GCCAATCACTCGATCCCATGCTTAAACAGGCGATTAGGGATTCTAGAATTGCTCTGGTCG
TGTTCTCAAAGAACTACGCCTCTTCAAGCTGGTGCCTTAATGAGCTGTTGGAGATTGTGA
AATGTAAGGAAGAGTTTGGTCAAATGGTGATTCCTATTTTCTACTGTTTGGATCCTTCCC
ATGTGAGGCATCAAGACGGTGACTTTGGAAAGAACTTTGAAGAGACTTGCGGGAGAAATA
CAGAGGAAGAGAAAATTCAATGGGAGAAAGCGTTGACTGATGTCGCAAATCTCGCTGGGT
TTGATTCTGTGACCTGGTATGCTTCTATACATCAGTAATTTGTGATTTCATTTATCGTGA
ATGAGCGTAGTTTCTTGTTTGGGTAAATAATCATCGTTTTCTCCTTGTTAGGGATGACGA
AGCAAAAATGATTGAAGAAATAGCCAATGATGTTTCGGGTAAACTGCTTTCAACTTCATC
CACGGATTCTGCTGAGAACTCTATTGGCATTGAAGATCATATTGCAAATATGAGTGTCTT
GTTGCAATTGGAAGCTGAGGAAGTGAGAATGGTTGGTATATGGGGTTCCTCGGGGATTGG
TAAGACTACCATTGCAAGAGCTCTGTTTAACCAACTTTCTCGGCATTTCCCAGTTAGCAA
ATTCATAGACAGAGCTTTTGTATATAAGAGTAGAGAAACTTACAAGGGCGCCAATCCGGA
CGACCCGAACATGAAGTTGCACTTGCAAGGATGTTTCCTATCGGAAATTTTGGGGAAAAA
AGACATAAAGATTGATCATTTAGGTGCACTGGGAGAGAGGCTAAAGCACCAGAAAACTCT
CATCATCATTGATGATTTGGATGATCTAGTGGTACTAGATTCATTGGTGGGTAAAACTAA
TTGGTTTGGATGTGGGAGCAGGATCATAGTGATTACCAATAATAAGCAATTCTTAAGGGC
CCATGGAATTGATCATATTTACGAAGTTAGTCTCCCTTCTAAAGAGCGCGCTCAAGAGAT
GTTTTGTCAGTCTGCTTTCGGGGAAAACTCTCCACCTGAAGGTTTTGAGGAGCTCGTAGT
TGAAATTGCATGGCTTGCTGGTAGTCTTCCTTTGGGTCTTACTGTTTTTGGTTCAGCTCT
ACGAGGAAGAAAAAAGGAGTACTGGGTGAAGATGTTGCCAAGGCTTCAAAATGATCTAGA
TGGCAATATTGAGGAGACATTGAAAGTCAGCTATGATGCGATAGGCAACGTAAAAGATCA
AGCGTTATTCCGTCTTATCGCATGTCTTTTCAATCACGTCAAAGTCAGAGACATTGAATT
GTTGCTCGCAGATAGTGGCTTAGATGTAAATATTGCACTGGAAAACCTAGTTGATAAGTC
CCTTATTCATGTCAGAAATGATCATGTGGAGATGCACCGTTTGCTACAAGAAACGGGTAG
AAATATTGTACGCTCACAGTCCACTGACAACCCAGGAGAACGAGAATTTCTGGTGGATTC
AAACGATAGTCGTACTGTACTCAGTGAAGGCATTGTAAGTCTTTTTTTTAGTTGTGCTAC
TTTCAGTATACGAGGTTAAGAAAGTGCCATTTGATGAATCATGAATTGTATGGTTTTGTC
TCTATCTCACTAATATCATATTTTTCAGGGTACTCGAAAGGTGCTAGGAATATCATTGGA
TACAAGTAAGGTTAGTGAGTTTTGTGTACATGAGAATGCCTTCAAAGGGATGGGTAATCT
CCTTTTCTTGGATATTTCCTCGAAGACTTTTATAGAAGAAGAAGTCAAAGTGCATTTACC
GGAAAAAATAAACTATTATTCCGTTCAACCCAAACAATTGATTTGGGATAGATTTCCACT
GAAATGTATGCCTTATACTTTTCTTCGAAACCTCGTCAAGCTCGAAATGCATGACAGCAA
GCTAGAGAAGCTGTGGGAAGGAGCTATGGTAAGGTTTAAGAATAAATTGTTAATGCTAAT
TGTAGTTTTTAAATGACGTGATGTGTAATTTCAACTGAGCTCTGCGTTTATTTTTGTCTG
AGTACAGTCATTTACATGTCTAAAGGAATTGGATATGTGGGCATCTAAATACCTGAAAGA
AATCCCAGATCTTTCAAAGGCCACTAACATTGAGAAACTTGACTTTGGACATTGCTGGAG
TTTGGTGGAGCTTCCTTCCTCTATACGAAATCTCAATAAACTGTTGGAATTGAATATGGA
ATACTGCGGTGAATTGGAGACTCTTCCTACGGGTTTCAACCTCAAATCCCTGGACTACCT
CAATTTCAATGAATGCTGGAAGTTGAGGACTTTTCCTGAATTCGCAACCAACATCTCAAA
TCTCATTCTGGCAGAAACATCTATTGAAGAATACCCTTCCAATTTGTATTTCAAGAATGT
CCGTGAGCTAAGCATGGGGAAAGCGGATAGTGATGAGAATAAATGCCAAGGAGTGAAGGT
ATATGTAGTTCTCTCCAATATCATGAGAATCCATTATATGTTTTTCTTTTCAAAGTGTAA
AGGTAAATCTTGCATTGAGTATTACCAAGTCAATCAACAAACAAAGAATGCAAAATGACA
AATGCAAATTTGTTTCGTAATGGAATTTGTTTTAGCTTAGATTAATTAATTGAAAAGTCC
CAAACTGTAAATTGTATTATTGGTGATTTTTGTTTAACATCTCTAAATTGTTTATTTGGT
TCAGCCCTTCATGCCGATGCTGTCTCCCACTTTGACCCTCTTGGAGCTCTGGAATATCCC
AAATTTAGTAGAGCTTTCGTCCTCATTTCAGAATCTCAATAACCTTGAGAGGTTGGACAT
TTGTTACTGCAGAAATCTGGAGTCTCTACCCACCGGAATCAACCTCGAATCTCTCGTTTC
CCTTAATCTCTTTGGATGCTCACGGTTGAAGCGCTTTCCTGATATCTCAACCAACATCAA
ATATCTCGATCTAGACCAAACTGGGATTGAAGAGGTTCCTTGGCAGATCGAGAACTTCTT
TAACCTCACTAAGCTAACTATGAAAGGTTGCCGCGAGCTAAAATGTGTATCCCTAAACAT
TTTTAAACTCAAACATCTTGGGGAAGTTAGCTTTTCCAATTGCGGGGCATTGACCAGAGT
TGATTTGAGTTGCTATCCAAGTGGGGTGGAGATGATGAAGGCAGACAATGCTGACATAGT
TTCTGAGGAGACCACCTCTTCTCTTCCTGATAGTTGCGTCCTCAATGTCAATTTCATGGA
TTGCGTCAATCTGGATCGAGAACCTGTCCTTCACCAACAGTCGATTATTTTCAACTCCAT
GATATTGCCAGGTGAAGAAGTGCCATCATATTTCACTTACCGAACATCTGACTCTCAACC
ATTTGGAACGTCTTCCTCTCTGCCCATCCCTCTACTTCCCACACAACTCTCTCAACCATT
CTTCAGATTTAGGGTTTGTGCAGTGGTAAGTGCTTCCAATGGAGTATATATCGGGGTATA
TAGTCGGTTCAAAGGCAGAATTGGGAACAAATTTGATTCCTTTGGTGAGCTACATAAATT
CATGGAAATTGAGAAGGGTATTCATCTGTGTATATTTGACTGTCGTATCCGTCTATACAA
AGATAATGTTCCTCTATCTCAACTGAACTATGATCATGTGGATATAAATATTCATATAAC
TAGTGGAGATTGGAGATCTACGGTCGTTTTAAAAGAATGGGGTATACGACTCTTAGAGGA
CTGTTCATCAGCGGAGAACCGACTTGGTAATCCAAACAGTACTCTTCCACATGTTTGTGT
AGAGGATGAAGAAAATTTGGTTAATGGGACTGAACAAGGTGATAGAGGTGATGTAGTGAC
GGAGACAAGCAGTAAACAGAATGAAGACGTTATCCTTCTGCAACGATCAGCTGATTCCAT
GTTCTCTAGGATGTCAGGAAAAGAAATGATTTCATATTTCACTCATCGCACTACTGGAAC
CTCTCTAACCAACATACCTCTACCTCACACCTCTCCCTCGCAACCGTTCTTCAGATTTAA
AGCTTTCGCAGTGGTTGGTTGCAAATCTTCTGGTCAGTTTTCATATTTTGTCACCCATAT
TTCTTGTCGATTCAAAGATGGATTTGAGAATCAACCACGTAGGCTTTATAAAGCTGAGAA
TGGTAACCACCTTGACATATATGAGTGCTCTTTCCCTCTATACCAAGGTAATGCTTCTCC
AGCTGAAATGAACTATGATCGCGTGGATATACAGCTTCATTTAAGGTATAGAAGTGACTC
TACGGTCAGATTAATAGTATGGGGTATACGCCTCATCGAGGACTGTTCATCATCCGAGAA
CCAACTTGGTTATCTAAATACTCTGTAGCATGTTCGTGAAGACAGTGAAACGGTGAGAGT
GCCAAAAGTTCCAAGAGGCTCAAGACATTGAGATAGGCTATGAGACTGATCAGAGTGAAG
AGCGTGGATACAGAGTGATGATATTGGTATAGACAGTGAGACTGATCAGTTTGAAGAGTG
TGGAAATAGTGATATAGGCCATGAGATTGATCAGAGTGAAGAATGTGAAGACATGGACGA
TACTGGTGGTATATGCATTGGGATTGATCAGAGTGAAGAGCGAGGAGACAGTGATGAATA
GTGATAGTGGCAGTGAGACTGATCACTTTGAAGAGTGCGAAGATAGTGATATAGGCAATG
AGATTGATCAGAGTGACTAATGAGATTGAATACAATGAAGAGAGTAGAGACAGAGAGAAC
CAGTACACAATGGCAGGTAAGTATTAATCAAGAACTGAACAGAATAACAGATATCTCGCC
GTCAGGATCTTTAATATTATAAATCACTGAGTTGTTTTCTTTTGCTTGCAGATTATGTGA
AAAAGAAATGAATCTTTGAGATACTTTTGTGGTGATGGAATGAGTAGTTTTGCTGCCGGT
TCTATGGAACAACAAGAAGAGCCCAAGATTCCTCATTGTCTCCCTAGCTAGACAGACATT
TTCAGGTGACCCAAAAAAACTCATAAACCATTTCATTTTAGTTCCACATCAATTGTAAAT
ACAGAGCATATATATAGTAGCATGCTTTTGAATTTCTGATTGTCTGGTTATAGACTTTTT
ATTATATAGATATTTGGCTGTATTCAATTGATAAATTTCACAGCCATCAATGTTGTTCAC
TGCTTGGTTAAAGACTTTGATATTATCTATTATGGGATAATTAGATACATGTGTGCTAGT
ATTATGAGGCATATATTTCAAAAAAAAGTCGTGATGTAGTTACAAAAATTGATGGAATTC
AAGCCACTGGTTTTTAATTAGATTATAAAGCTGAAGGAATGGAATTGTCTCAAATGGCAG
ATGAAGATGGTACTGTTCATGTCAATGTTTTATAATTTTTTGTTTTTTTTCTTAGGTTGC
ACGTTTGTGATAAGCTTATTTCATTACTATAACGATTTAATTTCTGAAGAACTATTTGTG
TTATTTGTGTTCACAAGAATTTGCTGTCTGGAACAAAGTTTTACAGTGTACCTGAATTGA
GTTTTCTTTTATTCGTTTTCGGATTTCACTCTCCACTAGTTGAAAAAGGTCTGAGGCTTT
CTAGATTGTTTCAAACTTCGTTAGGAACATGAAAATTTGCATCTAGACAATGCCCTGTGG
TATCTGGTAATCAAAATTCTGTTTCTGGTTACTTCGTTTTTACATGGGCAGAAAGTGAAT
CTCCTACAGGTCTTGCGACACAGTTAGCTTTTGATTTGATAAGCTTACTGTTACTTTAAC
CCTGTTGACATTTCTCACCTATGTCATTCGTTTGAAAGCTTGTTTTGATTCTCTAATGAT
ATGCTTAACTTTCATTCTCTGATGATTCTTTTGTCTTGCAATTGTTATTGTTCAGGAAAG
CTGGAGGAAGTCACTTTGATGACCAATGTTGGTTACGGATCTGACAAGATATTAATGTAA
GAATAAGAGGCTATGGACATGGTTTTTACTTGAGTGGTGGCGATTAAGTCCAAATCTAAA
AGAGATGATTAAGTCAAGATCCAGCAGAAAAGAGGAAACTTTCGTTAAGGTGTATGACAA
CAGTGGTGCAATTGCTAATGTTTGTGAATTGGTCTTTTTTCTTATTAGGGATATATAATG
AAGCAAGCATGATTGAAGAAATCGCCAAGTCTTAATCGGCTCACGTTAGGTGGTGGAAAG
ACGACGCATTGCAAAAGTTTTGCAGGCTGACGAAAAAAGAGGAGAATGGAGATCAATTGG
AAGAGGTTCTTCTTATTTGATTGGTTAATTTTTCTTTTCTTTCTATATTTAGATATACAT
GGTGACACCCATTATTGTCCAATTTGTCCCTTTTTTCTGTTTCTTTTGAGACCATGTCTA
TATATGAGAATTGAGAATCTTACAATTAAATATTTTGAACTAATAAGTCTTTTATTTTGT
TTCCAACTCATGTGTTTAACTAAGTCCTAAGCTAACACTAGATTTTTTTTAAAAGAAATT
TGGTTTTCCTCCACAGTATTTTTATTGTTTTTTGTGGACTTGACCACAAAACTTCAAAAG
ACTCGGAAGAAAATTAAACAAATATTATGCACAATTTCGCACCACTCAATGCCTTGCCTC
CCCTACCTAAAATGTTGACAATGTCGTCTTATTCTTTATGTCAAGCACGATGATGTGTCT
GACTTTAAGTAATTTACATTTTTTAAAAATTCGTGATAGATATTCTCCCAAATTCTTTCA
AATATCATAGGCTTTAAGATGTTACCAACTACCAAGTCTCCTAAAAAGACCAAAAAGTCT
CCTTAGATATTTATCAAACTCTTTGATGTTTTGTTGCTCGTTCCTTCGTTCACAGTTTCC
TGATTTAACAGTGGCCAGTAGGATAATGATTACGTTGCTTCACTTTTCACTGTTACTGTG
GAATTGCTTGGTAATTTCGAAAACTTGTATCCTTATTAAGAATTTGTAAAAAGTTTTGCA
ACTTCGTATTGTACATCTTTATTAAGAATTTGTAAATGAATGATATACAGTAGTAAAGAC
AAGAGGCTATGAAATATGGTTATGACGATTGAGTCAACAAAGAGGAAACTTCCGCCAAGT
AAAAGTCTAAGAAATAATTGTGAAAACTTGTATGGCCAAGTTACCTCTCAGCTGTTATGT
TAAATGTTTTATATCCACCAAGACAGACTCACTACTTGTCCTCTATTTCTCTTCTTAAAA
TCTCAATCTCCAAAGTCTTCGTTTCTAGTTTCCTCCTTCTAACTCTCTCTATGGCTTCTT
CATCTTCTTCTCGCAATTGGGTTTATGATGTTTTCTTGAGCTTCAGTGGGAAAGACGTCC
GCGTAACATTCCGTAGCCACTTTCTCAAAGAGCTTGATCGGAAACTGATCTCTGCTTTCA
GAGACAATGAGATCGAGAGAAGCCACTCTCTTTGGCCCGATCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1455, 1551..2673, 2788..3087, 3187..3597, 3844..5467, 5612..5895, 5991..6124, 7015..7075, 7248..7563
1001..1455, 1551..2673, 2788..3087, 3187..3597, 3844..5467, 5612..5760
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved