Arabidopsis_thaliana Locus RPL32B
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana RPL32B
Arabidopsis_thaliana
RPL32B
SnoR72
1554..1630
3298
ACCAGAGGAACCGAAAAAGCACAAAATTTTGATGAAATCTCCATGGGAGATACTTGAGT
CCCCGGTTGGCTCTGGAGGAGTCTTGAGCATCCTTGCTTCACATGGAACTACAGACTCTC
TTTCCACCCTGGGAATCAATTATCTTCAGGTATCGATATCTAAAGATCATCGCTTAATCT
CTTTGAACTTGACTCATATCCAGAAATTGTTCCTTTCTGGTTCTCTCCTTCAAATTTGGT
AAAAGGCATTAAGCTTTACGATGTTGGCATTTTTCTATAGGTACACAGTATTGAAACAAA
ACCACAACCGTCACAACATTACATCAATCCCATGCTTGTTGGTTTCGTGAGCGCAAGAGG
AGCAGAGATTGGGATCCAAGTGACCGAAGAATCTGAACTCAAGAACTTGGAAATGACATT
CTCAATGAAGTTTCTGAAGAGATTAAAGGGAAAAATCGAGTTTGAAGCTGTCATGAAGAT
GAATTCACATGTTCAGAATGTTGAAAAGGAGTGGGTTGAGTCAGTACCATCAGAACCAAA
CTCGTTTGAGTTTCGTTCTGATATTTACAGAGTCTTGAGTGAATGTTCTTCATCAGCTAA
GATTTGTTTGATGAACATTACCGTTTAGAACTTGTACATTTTGCTACTTAGTTGTTTGTC
CTCACATCTAAAAAGCTTCTAGAGACGCAATTTATGCCCGAACACATTACTCAAGCAAGA
GAGAACATCATTGTAGCTTTTGACAAATCGATGATAACAAAAACCCAAACCAAAGCTATT
GCTCTTTCATAGCACAAAAAAATATATTTTTTATCAAATTTCAAAAATATATCCCTCTTT
TTGGGAAACTTAAGATCCAACTGTTGATTTGCAGCCAAAAAAGATCGAACCGTTGATTCT
ATTGACCAATCTCTGATCTTTAACAAAATTACATTTTTGACCATCACACAGAGAACCCTA
ATTTATATATTTATAAGAAACTTCAGTCTTCCGAAAAACATCCTTTCACATTGCGGCGGA
GGAAGCTCTAATCACCGTAAGCTTCTCTCTTTCACTCTCTCTGAATCTCATCTTTCTGTT
AGTTTATGTATATATATCTACTGAAATCGATGCTTCGTCTCACGCATACCTTTTGTTGAT
TTTGTTGAGGAAGAGGAGTAAAAATGGCGGTTCCGTTGCTTACGAAGAAGGTGGTGAAGA
AGAGGTCTGCCAAATTCATCAGACCCCAGAGTGATCGCAGAATCACCGTCAAGGTACTCA
CTTTTTCTCCTTTTCAGGTTTAGAGATTCAACTTTTTTCATGGGTATAAGTTTGTTATTC
TCTGGAGTTTAGGCTTTGATAGTGAGGAAAAATGATTGCTTCCTCTGTATTATCATTAGG
TCTAAGTCTATCATCATTAGGTCTAAGTCTATCATCATTAGGTCTAAGTCTAGATTGTTT
CAGTATGATGCATTAGGGCTATGAGATTGTGCATCTAGATAATGCCCTGTGGTATCTGGT
AGCCAGAATTCTAATTCTGTTTCTGGTTACTTCGTTTTTACACGGGCAGAAAGTGAATCT
CCTACAGGTCTTGCGACACAGTTTGCTTTTGATTTGATAAGCTTACTGTTACTTTAACCC
TGTTGACATTTCTCATCTATCTCATTCGTCAAAAAGCTTGTTTTGATTCTCTGATGATTA
TGCTTAATCTTCATTCTCTGATTGTTCTTTTGTTTTTCAATTGTTATTGTTCAGGAAAGC
TGGAGGAGGCCTAAGGGTATTGACTCCCGGGTGAGAAGAAAGTTCAAGGGTGTCACCTTG
ATGCCCAATGTTGGTTACGGATCTGATAAGAAGACCCGCCACTACCTCCCAAATGGATTC
AAGAAGTTCATTGTTCACAACACCTCTGAGCTCGAGCTACTCATGATGCACAACAGGTAA
CTATTATGACTCCTTGGTGTTATACACCACAAGGATTTGATAGATTTTTTAAAGCAAGAT
TCTCATGGTGTGTTTTGCTTTGGATTTTTCACAGGACTTACTGTGCAGAGATTGCTCACA
ATATCTCAACAAAGAAGAGAAAGGCCATAGTGGAGAGAGCTTCTCAGCTAGACGTTGTTG
TTTCCAACAAGCTTGGTAGGTTGCGTAGCCAGGAAGACGAGTGAAAGCCCTAAAAGATAT
CATCTAGGGTTTTTCTTTTATCTGTCGTTAACTATTCCGAATTATCTTCTTTTTTTTTTT
TTTTTGCGTTTTGGAGAGTGGCTGAATGATATTACAACTTGGGTTCTCGTTTTTATGATA
TTAATTCAGAATCAGACACAGTCTCAGACCATAATTTATTCCTCAATTTATACCTAAATT
TTCAGACCATCGAAATTTAACTTGAGTTCAAAACTTTTATCGATACTGCCAAGTGTAACT
AAGTTAGGATAGCTGAGAGAGACACACTCCATTTCGTGCTTTAATCCCCACGTTGTCCAG
AAAGACTCGATGAGAGAATCTCAATCTTGTTCCATCTCCTCACGTGAGTCGTTACACCAA
GATGATTTGGGGATACACGAGGAACAAAAAATTAGTTGATGCGTTGAATCTGTTCGACGA
AATGCCTGAGAGAGAGATGTAAGGAGATGAATGTAGTTGCTGTGAAGCTAGGTTCAAGGG
TCGATTCCTTTGTGGCTAATTCTGTGGTTGTGATGTTCAGTGGAAACATGAACGACGCCG
TTTCAGTGTTCATAGATAATTGGAGGAAGAACCTTGTCTCGTGGAGTTCATCCATCGTGG
GTTTCTACAAAAAGGAAGAAAGCTTTTTGGTTACTTGTCAAGCGGACCAAATCATATCTA
GAAAGATTAAACACTACACTTGTAAGGTATATATCTTGGGAAGAAAAATAGATGTTGTGA
TATCGTAGTGACAGGCTTGCTGTTGCATTTGGGTTGGTTAGTATAGTTGAAGGAAGTAAA
GTCACTATGGTTTTTTGAAGATTGTCACACAGTGATTAAGTCTGATCTTAAGAGTTGTGG
GAACTGGGACGTGAGATTGTTTTAAGAGATTCGACTTGGTTTCATCATTTTAAGAATGGG
ATTTTTTCTTGTGGTTATTGGTAGAGGAGTACTTGAGAAAGTTGCAAAGTTTGACTTGTG
ATGTGAGGATAAGAGGGTAAGAGACTATAAATGTGATTGTGAGTTGTGTGGTGGTGGTAA
AGTCACGATCCATTCCAAAGGAGGAGCCTTCTGTCAAGTTGGCAGAAAAGTCTGAGAACC
ACTTGTGGAATTGCTAGTCACCACTTTGCCTCTGCTAAATTATATATGGGCAAATCACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 1149..1252, 1734..1915, 2014..2298
1163..1252, 1734..1915, 2014..2143
NC_003076.5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved