Arabidopsis_thaliana Locus Mono:SnoR67
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR67
Arabidopsis_thaliana
Mono:SnoR67
SnoR67
1001..1051
2051
TAATGAAAATAACATTCTGCAGAAAAAGAAACAAAAAGTCTGGTCAATAAAAGAGGGAA
AAAGGGCTCCGCAAGCAAGATTCGTTTCAAACATGGAAATTATTTAGTTCTATCTACTAC
ACACATACGGCATTTCATATGCTTCAATTTCAATTGTTTTGTTTTCTATTTGTATCTTGG
AAGTCAAGATCAAGATTAATCATCAGTGGACTCTATACAACTTGGGCCTATATTCTACTC
TATTATCTGATTTAGGGTTTGGCCCATTACTGAACAGCTTGGGGTTTCATTTTCTGTGTG
GGTGTTCAAGTTCTTGTTATTCACTGTAATGTCACGAGCAACTTGGAAAGTTCTAATTAT
TTTGAAATCATGAAAAATGTTGATAGCAGGAAAGATTTAGTCTTTCAACTAGGTTTTACT
TACAAATTCGAATCCAATACTGGTCGAAAGAGCTGTGATATCATAGTGATATCAAAGGAA
ATCAAGTGAAAAACGTAATCAGTGATCGACCATAATCATTTACAGTGTTAGTGTCCAGTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCACATGTCAAAGTGTCCAGTTTATTATATT
GTTTTGGAGAAGAATCAAGAAAAAGACTAGAGGATAAAACGTAGAGTGAGCCTTCCACAG
TATATTACAACTCTGAACTAATAAAGGCCCAATAATACAGGCCCATTTATGTAACAGGTC
GAATAATTATAAGCCCATAAAAAGTTCAATGAAACCCTAGCTCTAGACTACCACCGTCGG
GTATATATTGACGCTAAACACATGTTCTTACAAACCTACACTAAACACTGCAACACAGAT
ATTCAAAGCAACGCCTCTTTTACTCTTTTTCATCGAGTTATTATAAAAATTTCTTCCTTG
GTTCGTTTTAATTTTCTTCTTGATTTACGTTATTGTATTTGCCAAAATTTGATGGGAGAA
GAGAGCGATGATTATAAAAAAACAAGATTAAAATTCTGATCTGCTCTATTACTGGGCATG
ATAGACTCATATACACCCATAGAATATGAGCTCTCTTCTCAATCATCTATTTTTGTTTTC
CAAAAGACTTTATCAATAAGCATTGTCTGGATTAATTGAACAACTTGTAATTTTATCAAA
TTAGTTTCGTAATTGAACATCTCAAGAATTTCAATTGGATTAATAAATTTTAGGTTTTGT
TGATGATAAAAACAACTTAAGACAAGTGGTAAAATTTTCCGTAACCAGAACAAGGCTAAT
AAATAAGTGGACATATCTCTGTGACGGTTTGACCTATCATATGAATAACCTGTAACTTAT
TTTTCTTGCAATGGACTTTTAAATAAGAACTAGAATAAGACCAAGACTATGTTCACTTGG
TTGCGTTGTTAATAAGATGTTAAAACGAAGTTTATGTATAAAAAAATTGACAGAACATAA
CTACATTTCAAACTCCAAACTTACGAAAACACACAAGTTTTTTCTGGAATCTTTCAAGTT
TTATTTGATGTTTCGGAAGAACTAAATTGGGGTTTTATCTAGTGGTAGACAAAAAGGAAA
AAGATGAGTACATTTTATTGGGCAATGTGTTAACTAATAAAGTTTCTAGATATAGGCCCA
TAGAAAAACCAACTTATATAAACTGTAAGCCCATAAAGGCCCAAATAAACCCTAATTTTA
AATCCACCGACACATGTATAAATGCCAAGCCGTTTCATATACGTCTCCACTCTGCAACTC
AGGTAAAAGACTCTTGCTCCTATTATCTCATGTTCCATTGTTTGTTGATTTCAATTTGAA
ATATTAGTTTCTTTCTTCTTCCCTTCATTCCTTCAACTTTTATACCATTTTCCTGTTATC
TATTGATTTGAAAGTTTTAATTTTTAAGAGGCGGTGATGACAAAAAACATTTCTCGATGC
TGAAACTTACTCGAGAGACCAAATCACTCTTGTAATCTTTCGTGATGCTTGTTTTTATGC
GTGTCTGAGCCTAAACCAAAAAATCTTTCATTTATGCTTTGATTATCATAGATCCCAATT
TATGCGTTTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved