Arabidopsis_thaliana Locus Mono:SnoR65
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR65
Arabidopsis_thaliana
Mono:SnoR65
SnoR65
1001..1053
2053
acataactagctacatttcacattcattgacaaaccattagcttcaatattgatgaatt
tgagaagaaaacaaaggagactcattgtgttttacctgaccaggaccatgataagtaact
tcaccaccacgttctgttctataaacatcgaaaggagcattctttatgtcgaaattgaga
taattctctgagcttccagttcccattgtgtaaacagaaggatgttgtagtataattaat
gaatctgaacactcttggtttttatcaatcaaagcttttttctcattgagaatgcttttt
tgccatgaccaagctttcttgtatggaattaattgatcgtagagatcaaaacactcacac
ctgtaaaaatgtatactctgttatgcattgttgaagaatgcacgtaacgtgttcgttaaa
attcctcaaagagaaaataaagagagaggaacattactttcttgggtttgtgtgattctt
cgagttcattatcttgagagatgtagatactctgtttctgttgaagtcactaagatggtg
gtgatgatggagctttgggttcgtaacagagcttgttgcaacggaaaaaaccatgtcttt
cgagataaattatcaaactttaaggcttagaaatttcgaagaagcagaagttttggagta
atggcggagacaccaaggaaactgtgagagtattttcgaaataattgaacattgttaggg
ctattttggtcttttaacagagggtttgccctaatttctgggttcactatatatataata
caactgatacactgagaagttattgagaactgcaaatctttaaatctctgtttgtcaaaa
ttatcttttcgagctagctaaagcttacagattctggtttttgttatccttttaagatca
accttgagtttgttgttttacggtatttgcaattttgtatttgaagtttttctgtgaaaa
caaaaatggtggtgatgatgaagaaaaaatgaccttttatcacatgattgagatttttta
atctcgtgattacctttcaagcacttctgagccaccttttgatttttttgttctttatag
aattggttgtaattgataagctgaatttgctagccgcattgatttggccatgaaatgata
aaagatcgatttttttgtttaatgctttatttctggttgaacttgaatctgattatttga
cgatgattacagaattaacattagcaaactagaaaacttatctgcttgtcacatctgacg
atgattaccaaattatattttgacacatgggtaatatggaaaaaaggaccgtaaatgagc
tgctttagtgtaatatacaacattaacgattggcttttgattatacataaacttgaataa
caaagacccaaatattttgaccaaaatgaaaaagacccaagagtattaaagatttttgag
ataacaacattttaataacgcaacgaatcattttgatattgtagttaaatttttattggc
aattgaaagttttgaaacacacaaaatggctaattcataagattgttaatacatttgcta
agaaaacggttgatctgattggtatgtcagaaataaaggtctgacccgacaccatcttct
atatagcagatgacaaaataatccattttgataactattcaaggaacagtttctaactac
tcatacagaatatcccaaaatataatcaaaagaaaagatgaaaagcggactaaaagtgat
ggttccctctggtagggcgacatacatggttacgtttacgagcatgatcttcgttgtggt
gttgtgtcctacatgcgtatccataccaacaatcttccctagccgctacatccgctggca
aatgatttctcggcagtgttatccggaaccagtataaaaggaatcccaccagcttatcat
aacaatcactacatgtataaaacacaatcgaaagaaacttaagagaccttaaatctcaag
agtatacacactagaccatgaacttacttgcaaacatgtgttgatgcagttatcgtctca
gcatgattcagagg
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved