Arabidopsis_thaliana Locus Mono:SnoR66
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR66
Arabidopsis_thaliana
Mono:SnoR66
SnoR66
1001..1066
2066
TCGCATTTTTATACACATGTAACCAAAAACAAATTACTGTCCTACTTCTGCCATGTGAT
GTGCACTATCCTGTTAGAATTAATTATTGTTATCCTTTTCTTCTTTTTCCTTATTTTATG
ATCATCTCTCTCTTTTTTTCTTTTTTTTCTAAAACTATTGATTTGTGTAGTAGTGCGAAT
TAGCGTCTGTTTTTTTTTTTAAAAAAAAAAACTTTGATTGTTAGCTACGATAATAAAAAG
TTTTGTTTTATGTTTAATCAAAAATTACTAATATTTGTAAGATTTTATAATTCAGACTTA
TAATGTAGCTGTAACACTTGTTGTTTTTAAAAAGAAACTTATTTTCATTCTTATATTTGT
TTGTATAGTTTTGGTTTTGGATTTGATCTGAAGATAATAGGATTTTAACATCCATAGATA
ATGTTTGATGCAAATAACAAGAATCCATTTTCTGTTCAAAGTGTCAAGAGTTTTAAAATC
AGAAAGCATTATAAGAAATGAATGAATGATGTTTGAAAAAGACACGGGCCAAAGATTATT
TGCCAACTGGGTTATGCGTTTTCTCTGAGGCAGGCTTATAATAAAAGAAGAAAAGCCCAT
TAGTCTAGTATGAAGGCCCATTATGTTTGATGTTTGCGGCAGAAAAAACCCTAAGACCTA
AATTCATAAGTATGTATATAAACCAACACTTCCGGCGATGCCTAAAACATTCGATCTCTC
TTAAGCTAGGTTTAGTTTGCTGTGTTTTTACTATGTTTGTATATGATCTTTTAGAATCGT
TTTGTAGCTGATTGGATTCGCCTCTCAGATTGAATTTCCTGTAGAGTATTCAATATCTAC
GGGATGATTCTTTCATCGATTTTATTCGTGAGGCGATAGATTATTGCAGGGGCGTTGAGT
CGCTTCGTCTATGTTTAACCAGGCATAGCGAATAAGCTCGTGCTATATCCTAATCAGTTA
TCGTTTCTTTTTTAAAAAAGCTTATTGAAGGATCCTATGATGGCATGAAATCTTTGAGAC
CTGATTTTTTATTGATGAAAAGCTATAAGCATTTTTACTCTGAGGATCCTTATAATTTTT
TGTATCTGTTTCAATTTTTTTATCTGGCTAGAATAATTGTTGAGGGTCTAAGAAGGAAAA
GATGATGAATATGCACTGGGCTCTGAGTTGTTGATTGACATTCAACTTCTTTTTGATGCA
TAATGCAGCCTAGAAAGCTTAATCTGATTTTTCTTTCATTAGTACTCTCAAAGGTTTTAG
TATTAACAAGAACTTTATAGATTTATGGAATTGTATTTGATATTTTTTAGAAAAGGTCCA
TGAATCCATTTAATCAGAACTAACATTTAAGTCTTGCATAAGTAAAATGTTGAAGCCAAA
CGTTGCTCCACGACTTTGTTCTCCAAATCAAATCCGTACGAAAATTAAGTATTTCACCGA
AACCGCAAATTTGAGATAGTATGAAGAGTTGACAACTGTGGCACATAAATATCGAAACAG
TAATCCAAGAGCATCTTAAAATCTTTTTTGATCAATAAAGTTAAACCTAGAAATGTTGAA
GAATAACCACTGTTCGGGAATGAAGAATAATTATAAGTTACCAAAACAATTTTGATTAGA
GACTTGATGTTACATTCGAGAATAGTATGGTTACACGGCTATGTTACATTACATACTTTT
GACGAACGGCAAGAAGTAAAAGACTTGGAACTCATCAGAACTTTGAAGAGAAACACCAAA
AGTCAAACATAGCCGCTTAATACAAGAGAGAACTCATTACGTACGATAATGATGTTGTTT
TTTTCATTTTTGGTTTTTTCCATATGTTGCCTTTTTTTTATTCATTCTAGGCAAAAGTCA
TATAATCAAGTAAGAAGAAACATTGTTGTAAAATGTTTGGGATTCTCAGTGTTCAAGAGC
ACTCCGTATAGAGACTGTTGTGTCTTGGGTTGAGTTGATGTGGCCTCTCGATATGAGGTC
ATGGTTCAAGAACACCACTATAACCGTGATGTCATCATGAAAATGTCGTCTCACTTTCTT
GTCAATCTTCCTTAGATCTGAATATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved