Arabidopsis_thaliana Locus Mono:SnoR68
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Mono:SnoR68
Arabidopsis_thaliana
Mono:SnoR68
SnoR68
1001..1085
2085
TGCACGGCTTTTCCTCTTAATGGTACTTCCATGAATGGTGTATCTGTGATTAGTCGGGG
GAATTATTGGGAGGATCAACGGCCGTGTGATTTGTTGTCTAATTCCAAGTAAGCTTTGTG
AATAAGAAAACACCATAATGTTTGTATATATAGTCAGATAGGCATGAGCACAGCAGAAAT
GTTATAATTAATCTTGTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCATGGCCTTTTG
CAGAAACGTGGATTACAGACACAGTTATTTGCGTATGATATTTGATTATAGCCCAAAATT
TGCCTTGTACAAGTACATGACGACAGGCACGCGAAAGTACGTGGTATGGTTGAAACATCT
TAAGAAGTTTTTGGAGGAATGAAAGCTTAATTGATTTCGACGATACTTGAAGAGAATCAT
AAAATCTTTCACATGTGTTTAAGCATTTTGCAGTGTCTTTTTGAGAATTTATATATATGG
TAATGACTTTGGAGTTCAGATGCGAGTTTGGTATTATTCACTTTTAGTTTCCCAAACTCA
AATCCAAAAATAAAACGACGAGTGAAATAACCCATCACCAGAGGTACTAGTTAGTAACTA
GTAGTCATGGCACTAACCTATATATGATTTGTTACTTGTTGAAAAATGTTTAAAATCGAT
TGTGAATTCTCCATGACATTTTTTTACCATTAAGGCCCAATATAGGCCTCACTCACACAA
TGAGATTCATTGCACAAAGATAGGCTTTTTGAATAAACGTCCAGATCACAAAGATGGGCC
TAATCCACATCCGTTGATTTAGAATTCTAACGGCTATGATACGTCGCATTAACCCTAAAT
AATAGATGCTCTATATAAACTTATCTAAATTTTCTATTACTTCCACAGCTCATCTAGGGT
TTATAGCTCATCTTCTTCCTCGCCGTTTCGGCAACTTTACTTAGCTTTCAAATACGTTTT
TTTTTATAAATATCTTTGATTATCGAGCGATGCGATGAAGAGTTAATATCGGAAATAAAC
AGATCGTGGGACAAATCTCGTCTCGCGAGTTGATGTCCGATAATATTATGGTTCGTATTC
GCTGAGCATCGTATTCGTTGTAGCATGTTTAGAAATTAGGCAACGAAGGACCTATGGGTG
AAACGCTTTAATCAATGCGTATTCAAGCCAAGTTTACCTTCGGAAATTCATAATCGGAGA
TTGGTGGATTTATCCGAGATCTGTGTTTTCAATTCCGGATTTCGGTTTTTCATCCCTTAT
GGATTTGGTTTTCGATTAAATTCTTGTGATATGAGAATGTGATTAGAAGCAAAAGCGAAG
GACCCAGCAGGGAAGCGAGTAAACTCATGAAATGAGGCTTCTCTAACAATTTATTTAACC
TTCGTAGATTGAATCTCCAAGAGCTCTTTGATGATCTACGTTTTCGTGGGTTCTCTTGTG
TTTTTTGGTGTATAGCTAGTTTCATATGAAGTTTCAGTGTTGGTTTTGTTTAAATGCAGA
GATTGTGTGTATCGGCTTAGTGCGATGTAATGCGCTTTGTACGAAAGATTTCTCTGCGAC
ATTAATTTGGGGCAGATGGGCAGTTGTGATTCAATGTCAATTGAATAGCTCAACAATCAT
CTTCCCCACAATTCGTTTGATTCAACTTTACTCTAATTGTATTAGTTAGATTAGATATAC
ATTTTGACGGGGAAATTTGTGAATTTAGCAATTGTTGCAAGTTATCTGTGATGTTTTGAA
CTTATAATGATCTACTTGAACTTCAACACCACTGTTGAAAATTCCAAAAGCAGAGATATG
TGTGTATCGGCTTAGTGCGTTCAAATGCACTTTTCACGAAAGATTTCTTTGCAATATCCA
ATTTGGGGCAGATGGGCAGTTGTGATTCATCGTTCTATTGAATAGCTCAACAATCATCTT
CCCCACAGCTGAATCACTTCACTTCTTTAAGATATGATATAGAAGAGAGGGCTTTCAAAT
AAACTCACCTCAAAACAGGTTTAACTTATTTTCGGGGAAATTTAATCTGCAAATAATTGA
TCAATTGTTAAATGTTATGGGACGACTTGAGGACGGTTTTAATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved