Arabidopsis_thaliana Locus Poly:SnoR59a
snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana Poly:SnoR59a
Arabidopsis_thaliana
Poly:SnoR59a
1
SnoR59b, SnoR59a
1001..1099, 1157..1232
2232
GAGAAAAAAATAAAGGTATCGCAACAAGCATTCGACAATTCAAATCCCAAACCAAACAA
AACTAAAGAAACATTTAATATTTTGATGAGTCTCTTAATCATACAAGGCGTCTGCATAGA
GTGACACCATCACCTACGGAGACTAGAGAGACCTCGATGCGATGATCAGCAGCTAGCCGC
TTGTTCAACTCCAAAAAGACTTTTCTGTTCACCCTCATGTGCTCTGGCACGTTTCCTCTT
TCTCCGCCACAAACCCGTACCACAAAGTGTTATCAAACGCTATGATTCCTCCTACCTACC
TTCACCAGCTTCATTAGTCTCTCGTGCATGTTGGCATAGTTTGGTTTATCAGCATCAACA
AATGCAAAATCAAACTCTGGTTTTGGATTCTCCTGTGCTCCGATCCATTATCATTCACAA
ACCAATGTCATCAAATTAAGAGGAAAAAAATAGTGTATTTTAGTGCTTTCTCGTGTTATG
TTTTCTCAATATTTGTCTCCGAAATCTCATGGATTCATCGTCGGTCTATTTTTGTTTTTC
TTATGTTGCATCCCTACATGCTTTTAATCGTATTGTTGTAATCTCTAAGATGGTAGAACG
TGTAATAATCTTTGATATCGTTTGAGTATAATATGATTTTCGATAATAATAATAAAAATC
CTAAATGCATACTTCTAATTAAGTTGTTTAAAAAGTAAAAGAAATAAAGAATCTACAAAG
AAATATTATGGACTGATTTTGAAAGACCCAATAACAAAGGCCCATTAAAAGCCCATTTAC
TCAAAGATAGAGCTAGGGTTTACTCGCCCCAGCTCAGCCTCCCTCTTCCAGAGCCATATA
AATGACGCAGTGATGAAATTATCACATTACCAATCACTTTTAGTCGTTTTGATACTTCTG
TTCTCTCTTTATTGATTTTTTCACGCGTATTGATTCTATTATCGTTGTTTTGGGTTTTGA
TAAAATTCTTTCAAATCTAGCGATGTTTTTCAATTTGTGTAGAAATTGCCTCCGATGATG
ATCAAATCATAACTTTCGTTCTTCCGAGATTTTATCATGCGGAGAAATTATGGAGACCTG
AACTGAGCTGAGGCAATTTCATCATCTCTTTTCTTTTTGTTTTTACAAATTATGGTGTCT
TTTTTATCTGGGGTAAGCTCTTATGATGTCAAAACTTTCGTTCTCCTGAGATTTCAATAT
GCTGAAAAAAATTGGAGACCTGAACTGAAAGAGTACTTATTTCTTTGAAAACCCTTTTTT
GCTCTATTGTTTTTGTTTTCGTGACTATTTTCTTATGGTTTCATAAAAAATAAATTAATG
ACCCAAAATAATGAGCTTGATTTTGGATTATCACAGGCAACAAGGTGTTAAGAAAATAGG
AATAACTGATAATTTTGGGAATTAAAACTTGTAATTGATGATTATTTCTTGCTTAGTTTA
ACTTGAAACAAACAGATTGTATGGTCACATTATTCTCTGACTAATTCAATAAGTTGAAAT
CATTAAAAGAATTCAGAAATCTGACTCATGACTATTCCACAAGAAGAACAGAATCAATCT
GCATTAGTCTACCTTTACATCATTGGATTGTGATGAGATTAAGCCATAGGTTTGGATAAG
ATAACTACCTTAGCACACTGATAACAACCGAGGAAAATTACAGCATAAGGAATTATTTGC
CATCAGCTTATATACCAAAAGCGTGACTTTAACTAAAGACATATTACTCTTGATTTCGCC
GAAGTTAATGGAAATCAATGGGCATAATCAACATTACAACTCCACATATCCCCATTGCAA
ACCAAAAGTTGTAACTATTTCAGTGTTTAGCTGAGCAAAGTGACATGATTAATAAAACCG
GGGCAGGTCAAAGCTATATAATTTGATGAACCATTTGTTATTATTGTCTTCAGATGCTTT
TTTTTCTCACATAGAAAATCCCCAAACAAAATTCGATATTTGTTACACTATCAATTTCCC
TGGCTAGCTACAGTTTACAAGCTCAGTCATAAATCATCTGAAAAAAATTTCGAATAAGTC
AATTGCTATGAATATATCTGAAGTCTGGCAAGTCATTTATCAAACTCGGCGGAGCCAAAT
GACAAAGTAGACCCGCACGGTCATTGAATAGTACGTGTACAACATAAGCAGTGTTCAATA
CCAGTATTTGTCTCTCTCTTCGTTGAACAAACCAAAGGATCTGCAAATCATCACTCTCTA
CTTCCGATCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_003070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved